Incidental Mutation 'R5786:Abhd5'
ID448027
Institutional Source Beutler Lab
Gene Symbol Abhd5
Ensembl Gene ENSMUSG00000032540
Gene Nameabhydrolase domain containing 5
SynonymsNCIE2, IECN5, 2010002J10Rik, CGI-58, 1300003D03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122351608-122381524 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 122363803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035128] [ENSMUST00000111497] [ENSMUST00000154161] [ENSMUST00000154161] [ENSMUST00000156520] [ENSMUST00000175973]
Predicted Effect probably benign
Transcript: ENSMUST00000035128
Predicted Effect probably benign
Transcript: ENSMUST00000111497
SMART Domains Protein: ENSMUSP00000107123
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 3 189 7.8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154161
SMART Domains Protein: ENSMUSP00000122939
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 36 127 1.4e-8 PFAM
Pfam:Abhydrolase_6 37 127 1.5e-18 PFAM
Pfam:Abhydrolase_1 61 127 2.7e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154161
SMART Domains Protein: ENSMUSP00000122939
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 36 127 1.4e-8 PFAM
Pfam:Abhydrolase_6 37 127 1.5e-18 PFAM
Pfam:Abhydrolase_1 61 127 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156520
SMART Domains Protein: ENSMUSP00000122274
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Hydrolase_4 75 246 4.1e-11 PFAM
Pfam:Abhydrolase_1 78 208 6e-20 PFAM
Pfam:Abhydrolase_5 79 330 6.7e-11 PFAM
Pfam:Abhydrolase_6 80 342 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216775
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, impaired triacylglycerol catabolism, hepatic steatosis, and lethal skin barrier defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Abhd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Abhd5 APN 9 122368081 missense possibly damaging 0.73
IGL02143:Abhd5 APN 9 122365213 start codon destroyed probably null 0.01
IGL02949:Abhd5 APN 9 122377915 missense possibly damaging 0.51
IGL03248:Abhd5 APN 9 122368225 missense probably damaging 1.00
R0363:Abhd5 UTSW 9 122368146 missense possibly damaging 0.61
R1519:Abhd5 UTSW 9 122379014 splice site probably null
R2108:Abhd5 UTSW 9 122377940 missense probably damaging 1.00
R4818:Abhd5 UTSW 9 122363800 splice site probably null
R5048:Abhd5 UTSW 9 122377903 missense probably damaging 1.00
R6141:Abhd5 UTSW 9 122377933 missense probably benign 0.01
R6901:Abhd5 UTSW 9 122368155 missense probably benign 0.18
R7296:Abhd5 UTSW 9 122379573 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GTTTGTAAAGTTCTTGCCTCACAG -3'
(R):5'- GCTGGTGTGCATAGAGAAGC -3'

Sequencing Primer
(F):5'- TAAAGTTCTTGCCTCACAGGACCTAG -3'
(R):5'- AAAGGAGGCTTGCTCACTC -3'
Posted On2016-12-15