Incidental Mutation 'R5786:Tcf3'
ID448028
Institutional Source Beutler Lab
Gene Symbol Tcf3
Ensembl Gene ENSMUSG00000020167
Gene Nametranscription factor 3
SynonymsA1, ALF2, bHLHb21, E12, E2A, E47, Pan1, Pan2, Tcfe2a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R5786 (G1)
Quality Score172
Status Not validated
Chromosome10
Chromosomal Location80409514-80433647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80419499 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 157 (N157S)
Ref Sequence ENSEMBL: ENSMUSP00000100978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020377] [ENSMUST00000020379] [ENSMUST00000105339] [ENSMUST00000105340] [ENSMUST00000105341] [ENSMUST00000105342] [ENSMUST00000105343] [ENSMUST00000105344] [ENSMUST00000105345] [ENSMUST00000105346] [ENSMUST00000156244]
Predicted Effect probably benign
Transcript: ENSMUST00000020377
AA Change: N157S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020377
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
HLH 553 606 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020379
AA Change: N157S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020379
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105339
AA Change: N157S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100976
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
HLH 549 602 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105340
AA Change: N157S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100977
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105341
AA Change: N157S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100978
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
HLH 546 599 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105342
AA Change: N157S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100979
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
HLH 554 607 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105343
AA Change: N157S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100980
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105344
AA Change: N157S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100981
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
HLH 551 604 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105345
AA Change: N157S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000100982
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105346
AA Change: N157S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000100983
Gene: ENSMUSG00000020167
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
HLH 552 605 2.66e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129027
Predicted Effect probably benign
Transcript: ENSMUST00000156244
SMART Domains Protein: ENSMUSP00000120303
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156990
AA Change: N148S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121172
Gene: ENSMUSG00000020167
AA Change: N148S

DomainStartEndE-ValueType
low complexity region 47 65 N/A INTRINSIC
low complexity region 117 140 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
low complexity region 451 469 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
HLH 539 592 8.79e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations are devoid of mature B cells, have a partial early block in T-lymphocyte development, and show high postnatal mortality. Many survivors develop T-cell lymphomas between 3 and 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Tcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Tcf3 APN 10 80413209 missense probably benign 0.30
IGL02676:Tcf3 APN 10 80421091 missense probably damaging 1.00
IGL03066:Tcf3 APN 10 80413045 missense probably damaging 0.97
R0165:Tcf3 UTSW 10 80412997 missense probably damaging 1.00
R0401:Tcf3 UTSW 10 80421158 missense probably damaging 0.99
R0624:Tcf3 UTSW 10 80413334 missense probably damaging 1.00
R2114:Tcf3 UTSW 10 80410206 missense probably damaging 1.00
R5034:Tcf3 UTSW 10 80417543 missense possibly damaging 0.46
R5144:Tcf3 UTSW 10 80415237 missense probably damaging 0.98
R5347:Tcf3 UTSW 10 80410211 missense probably damaging 1.00
R5418:Tcf3 UTSW 10 80427683 missense probably damaging 1.00
R5771:Tcf3 UTSW 10 80421616 intron probably benign
R5941:Tcf3 UTSW 10 80413044 missense probably benign 0.06
R6857:Tcf3 UTSW 10 80416899 intron probably null
R6982:Tcf3 UTSW 10 80417550 missense probably damaging 1.00
R7178:Tcf3 UTSW 10 80421599 missense unknown
R7840:Tcf3 UTSW 10 80410467 missense possibly damaging 0.87
R7923:Tcf3 UTSW 10 80410467 missense possibly damaging 0.87
X0022:Tcf3 UTSW 10 80417458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCATGCTGTCCTAGGGGAG -3'
(R):5'- GTGCCAGTGATAGCTACAGC -3'

Sequencing Primer
(F):5'- TGTCCTAGGGGAGAGCAC -3'
(R):5'- TACAGCTGGCACCGCAG -3'
Posted On2016-12-15