Incidental Mutation 'R5786:Grn'
ID448036
Institutional Source Beutler Lab
Gene Symbol Grn
Ensembl Gene ENSMUSG00000034708
Gene Namegranulin
Synonymsprogranulin, epithelin, acrogranulin, PC cell-derived growth factor, Pgrn
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102430315-102437048 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 102434043 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 153 (Q153*)
Ref Sequence ENSEMBL: ENSMUSP00000135739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect probably benign
Transcript: ENSMUST00000049057
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000049460
AA Change: Q166*
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708
AA Change: Q166*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123500
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127530
Predicted Effect probably null
Transcript: ENSMUST00000129997
AA Change: Q153*
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708
AA Change: Q153*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176953
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some knock-out alleles display enhanced macrophage functions. Mice homozygous for another knock-out allele display reproductive and behavioral abnormalities. Mice homozygous for a third null allele display premature death and increased cellular aging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Grn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Grn APN 11 102436258 splice site probably benign
IGL02456:Grn APN 11 102436104 missense probably benign 0.01
PIT4434001:Grn UTSW 11 102435940 missense possibly damaging 0.88
R0395:Grn UTSW 11 102436223 missense probably benign 0.03
R0784:Grn UTSW 11 102434502 missense possibly damaging 0.74
R1037:Grn UTSW 11 102433070 missense possibly damaging 0.94
R1753:Grn UTSW 11 102433267 missense probably damaging 1.00
R1905:Grn UTSW 11 102436450 missense probably damaging 1.00
R3110:Grn UTSW 11 102433243 missense probably benign 0.07
R3111:Grn UTSW 11 102433243 missense probably benign 0.07
R3112:Grn UTSW 11 102433243 missense probably benign 0.07
R3974:Grn UTSW 11 102436339 missense probably damaging 1.00
R4908:Grn UTSW 11 102436518 unclassified probably benign
R4989:Grn UTSW 11 102430554 unclassified probably benign
R5012:Grn UTSW 11 102430554 unclassified probably benign
R5013:Grn UTSW 11 102430554 unclassified probably benign
R5108:Grn UTSW 11 102434402 missense probably benign 0.10
R5133:Grn UTSW 11 102430554 unclassified probably benign
R5134:Grn UTSW 11 102430554 unclassified probably benign
R5162:Grn UTSW 11 102430554 unclassified probably benign
R5182:Grn UTSW 11 102430554 unclassified probably benign
R5183:Grn UTSW 11 102430554 unclassified probably benign
R5308:Grn UTSW 11 102436192 missense possibly damaging 0.96
R5350:Grn UTSW 11 102436244 missense possibly damaging 0.50
R6383:Grn UTSW 11 102436795 unclassified probably benign
R7679:Grn UTSW 11 102433069 missense probably benign 0.01
R7741:Grn UTSW 11 102435734 missense probably damaging 1.00
R8312:Grn UTSW 11 102436247 missense probably damaging 0.98
R8677:Grn UTSW 11 102433567 missense possibly damaging 0.94
R8682:Grn UTSW 11 102434820 missense probably benign 0.04
R8864:Grn UTSW 11 102436385 missense unknown
Predicted Primers PCR Primer
(F):5'- TACCTGGGAGATCACCTAAGC -3'
(R):5'- ATCGTGTGTGAACCAGGTCAC -3'

Sequencing Primer
(F):5'- GCCACTAAACCTCCTGTAGCTGG -3'
(R):5'- AACCAGGTCACAGGAGGCC -3'
Posted On2016-12-15