Incidental Mutation 'R5786:Rad51ap2'
ID 448039
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5786 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11506921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 281 (D281V)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably damaging
Transcript: ENSMUST00000124065
AA Change: D281V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: D281V

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,945,122 (GRCm39) D200E probably damaging Het
4930578I06Rik C A 14: 64,210,691 (GRCm39) R179L probably damaging Het
Abhd5 A G 9: 122,192,868 (GRCm39) probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Ano5 G A 7: 51,216,066 (GRCm39) D348N possibly damaging Het
Apob C T 12: 8,065,304 (GRCm39) T4091I possibly damaging Het
Avil G A 10: 126,852,368 (GRCm39) probably null Het
Cacna1a T C 8: 85,142,350 (GRCm39) probably benign Het
Capn7 T C 14: 31,082,102 (GRCm39) L436P probably damaging Het
Ccdc33 A G 9: 57,937,235 (GRCm39) S655P possibly damaging Het
Ccr6 T C 17: 8,475,244 (GRCm39) S150P probably damaging Het
Cd1d1 T C 3: 86,906,095 (GRCm39) N60S probably benign Het
Ckap5 A G 2: 91,446,641 (GRCm39) probably null Het
Col15a1 A G 4: 47,280,865 (GRCm39) E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 (GRCm39) R699W unknown Het
Cracd T C 5: 77,014,043 (GRCm39) probably null Het
Csf2rb T C 15: 78,233,155 (GRCm39) Y821H probably damaging Het
Cyp3a11 A G 5: 145,799,284 (GRCm39) I301T possibly damaging Het
Dpp3 C T 19: 4,968,350 (GRCm39) G241R possibly damaging Het
Dpyd G T 3: 119,220,886 (GRCm39) M952I probably damaging Het
Dsg3 A T 18: 20,654,628 (GRCm39) I111L possibly damaging Het
Ect2 A G 3: 27,201,102 (GRCm39) F123L probably damaging Het
Ehmt2 G C 17: 35,129,719 (GRCm39) D961H probably damaging Het
Esp1 A G 17: 41,041,809 (GRCm39) I34V probably benign Het
Fam171b G A 2: 83,708,580 (GRCm39) V361I probably benign Het
Flnc T A 6: 29,459,536 (GRCm39) Y2545* probably null Het
Fmo4 C T 1: 162,631,286 (GRCm39) G227D probably benign Het
Grn C T 11: 102,324,869 (GRCm39) Q153* probably null Het
H2-DMb1 T G 17: 34,372,408 (GRCm39) S12R possibly damaging Het
Ica1 G T 6: 8,672,391 (GRCm39) N203K possibly damaging Het
Kdm4c C A 4: 74,277,722 (GRCm39) T792K probably damaging Het
Kif19a T A 11: 114,670,049 (GRCm39) Y81* probably null Het
Kifc2 G T 15: 76,548,578 (GRCm39) C440F probably damaging Het
Lpin2 A G 17: 71,537,268 (GRCm39) T234A probably benign Het
Lysmd2 C A 9: 75,542,885 (GRCm39) P164Q probably benign Het
Maea T A 5: 33,526,027 (GRCm39) D234E probably benign Het
Map4k1 T A 7: 28,699,445 (GRCm39) V572E probably damaging Het
Med6 C T 12: 81,620,733 (GRCm39) G166R probably null Het
Mtmr10 T C 7: 63,987,458 (GRCm39) I666T probably damaging Het
Myh14 T A 7: 44,262,887 (GRCm39) K1777M probably benign Het
Naip6 G T 13: 100,436,724 (GRCm39) Q600K probably benign Het
Obscn A G 11: 58,923,517 (GRCm39) S6461P probably damaging Het
Or1j4 T C 2: 36,740,061 (GRCm39) M1T probably null Het
Osbpl7 T A 11: 96,956,658 (GRCm39) V567E probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpl24 C A 16: 55,787,516 (GRCm39) H59N possibly damaging Het
Rtl1 G A 12: 109,559,053 (GRCm39) L929F possibly damaging Het
Runx3 C T 4: 134,890,575 (GRCm39) T159I probably damaging Het
Serpine2 T C 1: 79,794,637 (GRCm39) I99V probably benign Het
Slc12a6 C A 2: 112,115,067 (GRCm39) P12Q probably benign Het
Slc25a18 T C 6: 120,769,035 (GRCm39) L184P probably damaging Het
Smg1 T C 7: 117,812,120 (GRCm39) D57G probably benign Het
Spdye4c T A 2: 128,438,761 (GRCm39) *340K probably null Het
Srsf5 G A 12: 80,996,311 (GRCm39) E162K possibly damaging Het
Ssc5d T C 7: 4,939,817 (GRCm39) V751A probably benign Het
Tcf3 T C 10: 80,255,333 (GRCm39) N157S probably benign Het
Tdrd7 T C 4: 45,989,082 (GRCm39) V71A probably benign Het
Tex14 T C 11: 87,405,121 (GRCm39) C678R probably damaging Het
Tgm3 A T 2: 129,868,704 (GRCm39) K214* probably null Het
Vps53 A G 11: 75,953,833 (GRCm39) I659T probably benign Het
Zfp597 A T 16: 3,684,023 (GRCm39) C244* probably null Het
Zfp933 T A 4: 147,912,864 (GRCm39) probably null Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATTTCAAAACCAGGCCTGC -3'
(R):5'- CTCGCAATTTGCAACTTCTAGTG -3'

Sequencing Primer
(F):5'- CTGCTTGGAAAGTGCCAAACCTAG -3'
(R):5'- ACACTCAATACTACTGTGCCTATAG -3'
Posted On 2016-12-15