Incidental Mutation 'R5786:Dpp3'
ID448056
Institutional Source Beutler Lab
Gene Symbol Dpp3
Ensembl Gene ENSMUSG00000063904
Gene Namedipeptidylpeptidase 3
Synonyms4930533O14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4907229-4928287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4918322 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 241 (G241R)
Ref Sequence ENSEMBL: ENSMUSP00000025851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025851
AA Change: G241R

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904
AA Change: G241R

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Dpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Dpp3 APN 19 4913892 missense probably benign 0.00
IGL01657:Dpp3 APN 19 4918304 missense possibly damaging 0.72
IGL02105:Dpp3 APN 19 4916771 missense probably damaging 1.00
IGL02251:Dpp3 APN 19 4918315 missense probably benign
IGL02669:Dpp3 APN 19 4923682 critical splice donor site probably null
IGL02739:Dpp3 APN 19 4923728 missense probably damaging 1.00
IGL02851:Dpp3 APN 19 4923131 missense probably benign 0.06
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0053:Dpp3 UTSW 19 4923126 missense probably damaging 0.99
R0505:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R0681:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R1163:Dpp3 UTSW 19 4914923 nonsense probably null
R1200:Dpp3 UTSW 19 4923129 missense probably benign
R1761:Dpp3 UTSW 19 4921149 missense probably benign 0.37
R1931:Dpp3 UTSW 19 4917860 splice site probably benign
R2255:Dpp3 UTSW 19 4918319 missense probably benign
R2424:Dpp3 UTSW 19 4907707 nonsense probably null
R3718:Dpp3 UTSW 19 4923065 critical splice donor site probably null
R3727:Dpp3 UTSW 19 4923185 missense probably benign 0.30
R5080:Dpp3 UTSW 19 4915080 missense probably benign 0.00
R5587:Dpp3 UTSW 19 4918267 missense probably damaging 0.98
R5986:Dpp3 UTSW 19 4918357 missense probably benign 0.18
R6128:Dpp3 UTSW 19 4922392 missense probably benign 0.05
R6989:Dpp3 UTSW 19 4921167 missense probably damaging 1.00
R7019:Dpp3 UTSW 19 4916789 missense possibly damaging 0.83
R7070:Dpp3 UTSW 19 4918328 missense probably benign 0.24
R7100:Dpp3 UTSW 19 4918041 missense probably damaging 1.00
R7265:Dpp3 UTSW 19 4923769 missense probably damaging 1.00
R7495:Dpp3 UTSW 19 4917913 missense probably damaging 1.00
R7916:Dpp3 UTSW 19 4917024 nonsense probably null
Z1176:Dpp3 UTSW 19 4922341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATAAGCCTAGAGGTGAG -3'
(R):5'- GCCTGTGCACAAATGTCCTG -3'

Sequencing Primer
(F):5'- GACGGTTTTGGTCAATCCTGGAC -3'
(R):5'- GACAAGGTCTTACTCTAGTCAGGC -3'
Posted On2016-12-15