Incidental Mutation 'R5787:Des'
ID448057
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75363646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 399 (V399E)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect probably damaging
Transcript: ENSMUST00000027409
AA Change: V399E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: V399E

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152799
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0032:Des UTSW 1 75362166 missense possibly damaging 0.87
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1271:Des UTSW 1 75360646 missense probably benign 0.01
R1452:Des UTSW 1 75363477 missense probably damaging 1.00
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4182:Des UTSW 1 75362584 missense probably benign 0.00
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R4383:Des UTSW 1 75360769 missense possibly damaging 0.94
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
R7359:Des UTSW 1 75360952 missense probably damaging 1.00
R7467:Des UTSW 1 75362961 missense possibly damaging 0.48
R7798:Des UTSW 1 75362359 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCATCCCTTGCAGAACGACTC -3'
(R):5'- TTGTGCTTTACCCAAGTGGC -3'

Sequencing Primer
(F):5'- TTGCAGAACGACTCCCTGATGAG -3'
(R):5'- AAGTGGCCCTCGTTAATTTTCTG -3'
Posted On2016-12-15