Mutagenetix > Incidental Mutations

Incidental Mutation 'R0546:Itgav'

44806

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

038738-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83803242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 978 (M978I)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably benign
Transcript: ENSMUST00000028499
AA Change: M1014I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: M1014I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111740
AA Change: M978I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: M978I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000125402
AA Change: M89I

SMART Domains

Protein: ENSMUSP00000118016
Gene: ENSMUSG00000027087
AA Change: M89I

Domain	Start	End	E-Value	Type
SCOP:d1m1xa3	2	58	7e-19	SMART
PDB:3IJE\|A	2	69	3e-41	PDB
low complexity region	71	84	N/A	INTRINSIC
Pfam:Integrin_alpha	89	103	1.4e-8	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000131192
AA Change: M28I

SMART Domains

Protein: ENSMUSP00000121295
Gene: ENSMUSG00000027087
AA Change: M28I

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Integrin_alpha	28	42	4.5e-9	PFAM

Meta Mutation Damage Score

0.1030

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	G	6: 23,077,077		probably null	Het
Actn1	C	T	12: 80,178,434	R418Q	probably benign	Het
Adam39	G	A	8: 40,826,431	V620M	probably damaging	Het
Agr3	C	A	12: 35,928,330	T14K	probably benign	Het
Alpk2	T	C	18: 65,306,717	D1002G	probably benign	Het
Amz2	T	A	11: 109,433,954	N221K	probably benign	Het
Aox4	A	G	1: 58,250,174	E752G	probably damaging	Het
Ap2a1	C	T	7: 44,904,708	G500S	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc112	A	G	18: 46,291,072	S200P	possibly damaging	Het
Ccdc18	A	T	5: 108,174,964	E643D	probably benign	Het
Ccdc180	A	T	4: 45,904,597	T398S	possibly damaging	Het
Cnp	A	G	11: 100,580,723	Y397C	probably damaging	Het
Cpa4	T	C	6: 30,580,963	W184R	probably damaging	Het
Crebbp	A	T	16: 4,085,807	I1856N	probably damaging	Het
Ctrl	A	G	8: 105,932,334	I200T	probably damaging	Het
Cyfip1	C	T	7: 55,922,816	R934*	probably null	Het
Dennd5a	A	G	7: 109,921,426	V408A	probably benign	Het
Dhfr	G	A	13: 92,368,184		probably null	Het
Dnajc6	A	T	4: 101,635,191	N740Y	probably damaging	Het
Fam110a	T	C	2: 151,970,812	T13A	probably benign	Het
Fars2	G	T	13: 36,204,586	K19N	probably benign	Het
Fer1l6	A	T	15: 58,558,408		probably null	Het
Gabra1	T	A	11: 42,162,601	T69S	probably damaging	Het
Galnt18	T	G	7: 111,508,141	N475T	probably damaging	Het
Gbp4	T	C	5: 105,120,970	Y439C	probably damaging	Het
Gpatch2l	A	G	12: 86,288,848	*409W	probably null	Het
Hip1r	T	C	5: 123,999,051	V658A	possibly damaging	Het
Hspg2	A	G	4: 137,502,294	D73G	probably benign	Het
Ifitm2	A	G	7: 140,955,743	V58A	possibly damaging	Het
Ift172	T	C	5: 31,257,601	D1359G	probably benign	Het
Ing1	A	G	8: 11,557,031	D41G	probably damaging	Het
Itgal	C	T	7: 127,310,314	T446I	probably benign	Het
Jazf1	A	G	6: 52,777,696	Y132H	possibly damaging	Het
Lgr4	T	A	2: 109,999,421	N211K	probably damaging	Het
Mgat4d	A	G	8: 83,355,721	N100S	possibly damaging	Het
Mrgprb3	T	C	7: 48,643,515	Y96C	probably damaging	Het
Myh11	A	C	16: 14,205,628	L1562R	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo15	A	G	11: 60,506,313	Y2667C	probably damaging	Het
Olfr1084	T	A	2: 86,639,229	T160S	possibly damaging	Het
Olfr1085	C	T	2: 86,657,891	C189Y	possibly damaging	Het
Olfr1158	T	A	2: 87,990,472	Y120*	probably null	Het
Olfr128	T	A	17: 37,924,338	C257*	probably null	Het
Olfr608	A	G	7: 103,470,700	I220M	possibly damaging	Het
Olfr814	G	A	10: 129,874,538	T73I	possibly damaging	Het
Paox	G	T	7: 140,131,678	G148W	probably damaging	Het
Pkd1	T	C	17: 24,580,138	V2777A	probably benign	Het
Plod2	T	A	9: 92,595,335	V360E	probably damaging	Het
Prune2	T	C	19: 17,020,666		probably benign	Het
Sbds	G	T	5: 130,254,078	A3D	possibly damaging	Het
Sec23a	T	C	12: 58,985,167	T426A	probably benign	Het
Sec31a	T	C	5: 100,404,070	Y148C	probably damaging	Het
Shprh	T	A	10: 11,183,887		probably benign	Het
Slc16a7	A	G	10: 125,230,873	V299A	probably benign	Het
Smg8	T	C	11: 87,083,613	Y174C	possibly damaging	Het
Snx22	T	A	9: 66,068,777	Y58F	probably damaging	Het
Snx25	A	G	8: 46,103,630	Y308H	probably benign	Het
St3gal2	A	G	8: 110,970,106		probably null	Het
Stab1	C	T	14: 31,139,550	R2500H	possibly damaging	Het
Steap4	T	C	5: 7,975,870	S144P	probably damaging	Het
Stfa3	T	A	16: 36,452,257		probably benign	Het
Tmprss9	C	A	10: 80,899,323	Q1095K	probably benign	Het
Top2a	A	G	11: 98,999,226	V1217A	possibly damaging	Het
Trhr2	A	G	8: 122,358,489		probably null	Het
Trim7	A	G	11: 48,845,509	E23G	probably damaging	Het
Trpv3	A	T	11: 73,297,187	E788V	probably damaging	Het
Ttn	A	G	2: 76,745,519	I25010T	probably damaging	Het
Ube2ql1	T	C	13: 69,739,300	H14R	unknown	Het
Uggt1	C	T	1: 36,195,971	R419H	probably benign	Het
Xpo4	A	G	14: 57,613,274	V391A	probably benign	Het
Zfhx3	A	G	8: 108,794,187	D647G	probably damaging	Het
Zfp354c	A	T	11: 50,815,630	M206K	probably benign	Het
Zfp804a	A	G	2: 82,258,920	N1031S	possibly damaging	Het
Zfp868	A	G	8: 69,612,231	V151A	probably benign	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGATCATCTTGGCAGTTCTCGCAG -3'
(R):5'- ACGAGAGATGTTGAAATCCACCACC -3'

Sequencing Primer
(F):5'- AGGGCTGCTGCTACTGG -3'
(R):5'- ACCACGGTGGTGAACTTG -3'

Posted On

2013-06-11