Incidental Mutation 'R5787:Nos1ap'
ID448061
Institutional Source Beutler Lab
Gene Symbol Nos1ap
Ensembl Gene ENSMUSG00000038473
Gene Namenitric oxide synthase 1 (neuronal) adaptor protein
Synonyms6330408P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170302668-170589861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170318572 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 471 (E471G)
Ref Sequence ENSEMBL: ENSMUSP00000125251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160456]
Predicted Effect probably benign
Transcript: ENSMUST00000160456
AA Change: E471G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125251
Gene: ENSMUSG00000038473
AA Change: E471G

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 313 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162709
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Nos1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Nos1ap APN 1 170514606 splice site probably benign
IGL01151:Nos1ap APN 1 170589276 missense probably damaging 1.00
IGL02056:Nos1ap APN 1 170318623 missense possibly damaging 0.93
IGL02712:Nos1ap APN 1 170329251 missense possibly damaging 0.93
IGL03177:Nos1ap APN 1 170390730 critical splice donor site probably null
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0621:Nos1ap UTSW 1 170318581 missense probably damaging 0.99
R1332:Nos1ap UTSW 1 170349432 missense probably damaging 1.00
R1523:Nos1ap UTSW 1 170338118 missense probably benign 0.03
R1660:Nos1ap UTSW 1 170514637 missense possibly damaging 0.89
R1704:Nos1ap UTSW 1 170338212 missense probably damaging 1.00
R1764:Nos1ap UTSW 1 170318878 missense possibly damaging 0.83
R1905:Nos1ap UTSW 1 170318558 missense possibly damaging 0.70
R2056:Nos1ap UTSW 1 170327646 missense probably damaging 1.00
R2140:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R2141:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R3890:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3891:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3892:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R4109:Nos1ap UTSW 1 170318668 missense probably benign
R5305:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5306:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5412:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5414:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5444:Nos1ap UTSW 1 170375251 missense probably damaging 1.00
R5636:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5637:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5638:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5753:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5754:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R7060:Nos1ap UTSW 1 170338125 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCCTGGGTGTTGTTCTCAG -3'
(R):5'- TGCTCTGTGAATCCACCACC -3'

Sequencing Primer
(F):5'- TGTTGTTCTCAGCAGCGC -3'
(R):5'- TACACTCACCACTGCTGGG -3'
Posted On2016-12-15