Mutagenetix > Incidental Mutations

Incidental Mutation 'R5787:Ccdc174'

448077

Institutional Source

Beutler Lab

Gene Symbol

Ccdc174

Ensembl Gene

ENSMUSG00000034083

Gene Name

coiled-coil domain containing 174

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5787 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91878053-91899843 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 91881310 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 71 (Q71*)

Ref Sequence

ENSEMBL: ENSMUSP00000146317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]

Predicted Effect

probably null
Transcript: ENSMUST00000037783
AA Change: Q71*

SMART Domains

Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: Q71*

Domain	Start	End	E-Value	Type
low complexity region	21	36	N/A	INTRINSIC
coiled coil region	64	98	N/A	INTRINSIC
low complexity region	137	152	N/A	INTRINSIC
Pfam:DUF4078	215	303	4.4e-32	PFAM
low complexity region	323	340	N/A	INTRINSIC
low complexity region	423	446	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000136090
AA Change: Q71*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206250

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,992,733		probably null	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Adam24	A	G	8: 40,680,902	N470D	possibly damaging	Het
Adcy8	T	C	15: 64,704,218	D1027G	probably damaging	Het
Amph	A	T	13: 18,948,454	I8F	possibly damaging	Het
Ankrd60	TGGCCACGCGG	TGG	2: 173,578,089		probably null	Het
Ano5	G	A	7: 51,566,318	D348N	possibly damaging	Het
Atp6v0a1	A	G	11: 101,018,574	D43G	probably benign	Het
Btnl10	T	A	11: 58,920,343	I164N	probably damaging	Het
Ceacam3	G	A	7: 17,155,046	E247K	possibly damaging	Het
Chrna2	A	G	14: 66,149,008	D201G	probably benign	Het
Clasp2	G	A	9: 113,862,242	D448N	probably damaging	Het
Clcn2	C	A	16: 20,703,433	R829L	probably damaging	Het
Clock	A	G	5: 76,237,051	S440P	probably damaging	Het
Cntn2	T	C	1: 132,523,059	D29G	probably damaging	Het
Cpne4	A	G	9: 105,022,401	T428A	probably benign	Het
Cul3	T	C	1: 80,282,721	I304V	probably benign	Het
Cyp11a1	C	A	9: 58,015,267	Q77K	probably benign	Het
Cyp3a25	A	G	5: 145,998,503	V101A	probably benign	Het
Cyp4f15	T	C	17: 32,702,808	F485L	probably damaging	Het
Des	T	A	1: 75,363,646	V399E	probably damaging	Het
Dhx58	T	C	11: 100,701,319	D301G	possibly damaging	Het
Ear6	A	G	14: 51,854,398	E134G	probably benign	Het
Eif2b3	A	G	4: 117,044,440	D100G	probably damaging	Het
Erich1	T	C	8: 14,033,776		probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Htr4	T	C	18: 62,413,622	V82A	probably damaging	Het
Hydin	A	G	8: 110,326,353	D219G	probably damaging	Het
Ifit1	T	A	19: 34,647,575	V37E	probably benign	Het
Isg20	T	A	7: 78,919,810	D176E	probably benign	Het
Islr2	A	G	9: 58,198,354	V585A	probably damaging	Het
Kat6a	A	G	8: 22,932,647	E991G	probably damaging	Het
Kcnv1	T	C	15: 45,114,330	Y104C	probably damaging	Het
Lrtm1	G	C	14: 29,021,990	E138D	possibly damaging	Het
Mllt3	A	T	4: 87,840,820	D330E	probably damaging	Het
Mpp7	T	C	18: 7,461,682	N64D	probably benign	Het
Naip6	G	T	13: 100,300,216	Q600K	probably benign	Het
Nop9	T	G	14: 55,746,334	C141G	possibly damaging	Het
Nos1ap	T	C	1: 170,318,572	E471G	probably benign	Het
Npr2	A	G	4: 43,633,593	T246A	possibly damaging	Het
Olfr1249	T	A	2: 89,630,674	I75F	probably benign	Het
Olfr1348	A	T	7: 6,501,990	S79T	probably damaging	Het
Olfr31	A	C	14: 14,328,725	M205L	probably damaging	Het
Pdlim4	T	A	11: 54,055,216	D271V	probably damaging	Het
Pik3r6	T	C	11: 68,539,927	V518A	possibly damaging	Het
Rab5a	C	T	17: 53,497,622	P87S	probably damaging	Het
Rbsn	C	T	6: 92,199,816	V239I	possibly damaging	Het
Rsph14	T	A	10: 74,957,628	I314F	possibly damaging	Het
S1pr2	A	T	9: 20,967,936	S199T	probably benign	Het
Scrib	A	G	15: 76,059,302	L902P	probably damaging	Het
Slc25a23	T	C	17: 57,053,825	T200A	probably damaging	Het
Slc8a1	A	T	17: 81,388,737	I956N	probably damaging	Het
Spef2	A	G	15: 9,748,726	V15A	possibly damaging	Het
Stim1	T	A	7: 102,435,440	V533E	possibly damaging	Het
Tbck	A	T	3: 132,737,568	D585V	probably damaging	Het
Tpr	T	A	1: 150,395,286	L80Q	probably benign	Het
Trim67	C	T	8: 124,794,312	R138*	probably null	Het
Ttn	T	C	2: 76,750,283	N23422S	probably damaging	Het
Uba6	A	G	5: 86,112,652	*1023Q	probably null	Het
Vmn1r208	T	C	13: 22,772,671	N219D	possibly damaging	Het
Vmn1r8	T	A	6: 57,036,259	S98R	probably damaging	Het

Other mutations in Ccdc174

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01633:Ccdc174	APN	6	91880362	critical splice donor site	probably null
IGL02391:Ccdc174	APN	6	91898282	missense	possibly damaging	0.72
IGL02619:Ccdc174	APN	6	91899557	missense	possibly damaging	0.70
IGL02698:Ccdc174	APN	6	91890853	missense	probably benign
R0482:Ccdc174	UTSW	6	91895266	missense	probably benign	0.08
R0612:Ccdc174	UTSW	6	91890892	splice site	probably benign
R0801:Ccdc174	UTSW	6	91895332	missense	possibly damaging	0.72
R1124:Ccdc174	UTSW	6	91899580	missense	probably benign	0.33
R1237:Ccdc174	UTSW	6	91890787	splice site	probably benign
R1388:Ccdc174	UTSW	6	91881244	splice site	probably null
R2176:Ccdc174	UTSW	6	91888089	missense	probably benign	0.01
R3914:Ccdc174	UTSW	6	91899357	missense	possibly damaging	0.70
R4342:Ccdc174	UTSW	6	91885356	nonsense	probably null
R4775:Ccdc174	UTSW	6	91890894	splice site	probably null
R4880:Ccdc174	UTSW	6	91899591	unclassified	probably benign
R5579:Ccdc174	UTSW	6	91881350	splice site	probably null
R5869:Ccdc174	UTSW	6	91885418	utr 3 prime	probably benign
R6277:Ccdc174	UTSW	6	91880291	missense	probably damaging	1.00
RF008:Ccdc174	UTSW	6	91899366	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GGAGGCTGTAAATTAGTTGTCAGAG -3'
(R):5'- TTGGCCCTTCATATCCAGAGTC -3'

Sequencing Primer
(F):5'- AGTTGTCAGAGTAAGTAGTTCTCTG -3'
(R):5'- TGCACCATTTTAGGCATAGCAAGG -3'

Posted On

2016-12-15