Incidental Mutation 'R0546:Olfr1158'
ID44809
Institutional Source Beutler Lab
Gene Symbol Olfr1158
Ensembl Gene ENSMUSG00000062793
Gene Nameolfactory receptor 1158
SynonymsMOR173-3, GA_x6K02T2Q125-49480812-49481753
MMRRC Submission 038738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0546 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87990113-87991054 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87990472 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 120 (Y120*)
Ref Sequence ENSEMBL: ENSMUSP00000099682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102622]
Predicted Effect probably null
Transcript: ENSMUST00000102622
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000099682
Gene: ENSMUSG00000062793
AA Change: Y120*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-45 PFAM
Pfam:7tm_1 41 289 4.5e-15 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,077,077 probably null Het
Actn1 C T 12: 80,178,434 R418Q probably benign Het
Adam39 G A 8: 40,826,431 V620M probably damaging Het
Agr3 C A 12: 35,928,330 T14K probably benign Het
Alpk2 T C 18: 65,306,717 D1002G probably benign Het
Amz2 T A 11: 109,433,954 N221K probably benign Het
Aox4 A G 1: 58,250,174 E752G probably damaging Het
Ap2a1 C T 7: 44,904,708 G500S probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc112 A G 18: 46,291,072 S200P possibly damaging Het
Ccdc18 A T 5: 108,174,964 E643D probably benign Het
Ccdc180 A T 4: 45,904,597 T398S possibly damaging Het
Cnp A G 11: 100,580,723 Y397C probably damaging Het
Cpa4 T C 6: 30,580,963 W184R probably damaging Het
Crebbp A T 16: 4,085,807 I1856N probably damaging Het
Ctrl A G 8: 105,932,334 I200T probably damaging Het
Cyfip1 C T 7: 55,922,816 R934* probably null Het
Dennd5a A G 7: 109,921,426 V408A probably benign Het
Dhfr G A 13: 92,368,184 probably null Het
Dnajc6 A T 4: 101,635,191 N740Y probably damaging Het
Fam110a T C 2: 151,970,812 T13A probably benign Het
Fars2 G T 13: 36,204,586 K19N probably benign Het
Fer1l6 A T 15: 58,558,408 probably null Het
Gabra1 T A 11: 42,162,601 T69S probably damaging Het
Galnt18 T G 7: 111,508,141 N475T probably damaging Het
Gbp4 T C 5: 105,120,970 Y439C probably damaging Het
Gpatch2l A G 12: 86,288,848 *409W probably null Het
Hip1r T C 5: 123,999,051 V658A possibly damaging Het
Hspg2 A G 4: 137,502,294 D73G probably benign Het
Ifitm2 A G 7: 140,955,743 V58A possibly damaging Het
Ift172 T C 5: 31,257,601 D1359G probably benign Het
Ing1 A G 8: 11,557,031 D41G probably damaging Het
Itgal C T 7: 127,310,314 T446I probably benign Het
Itgav G T 2: 83,803,242 M978I probably benign Het
Jazf1 A G 6: 52,777,696 Y132H possibly damaging Het
Lgr4 T A 2: 109,999,421 N211K probably damaging Het
Mgat4d A G 8: 83,355,721 N100S possibly damaging Het
Mrgprb3 T C 7: 48,643,515 Y96C probably damaging Het
Myh11 A C 16: 14,205,628 L1562R probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo15 A G 11: 60,506,313 Y2667C probably damaging Het
Olfr1084 T A 2: 86,639,229 T160S possibly damaging Het
Olfr1085 C T 2: 86,657,891 C189Y possibly damaging Het
Olfr128 T A 17: 37,924,338 C257* probably null Het
Olfr608 A G 7: 103,470,700 I220M possibly damaging Het
Olfr814 G A 10: 129,874,538 T73I possibly damaging Het
Paox G T 7: 140,131,678 G148W probably damaging Het
Pkd1 T C 17: 24,580,138 V2777A probably benign Het
Plod2 T A 9: 92,595,335 V360E probably damaging Het
Prune2 T C 19: 17,020,666 probably benign Het
Sbds G T 5: 130,254,078 A3D possibly damaging Het
Sec23a T C 12: 58,985,167 T426A probably benign Het
Sec31a T C 5: 100,404,070 Y148C probably damaging Het
Shprh T A 10: 11,183,887 probably benign Het
Slc16a7 A G 10: 125,230,873 V299A probably benign Het
Smg8 T C 11: 87,083,613 Y174C possibly damaging Het
Snx22 T A 9: 66,068,777 Y58F probably damaging Het
Snx25 A G 8: 46,103,630 Y308H probably benign Het
St3gal2 A G 8: 110,970,106 probably null Het
Stab1 C T 14: 31,139,550 R2500H possibly damaging Het
Steap4 T C 5: 7,975,870 S144P probably damaging Het
Stfa3 T A 16: 36,452,257 probably benign Het
Tmprss9 C A 10: 80,899,323 Q1095K probably benign Het
Top2a A G 11: 98,999,226 V1217A possibly damaging Het
Trhr2 A G 8: 122,358,489 probably null Het
Trim7 A G 11: 48,845,509 E23G probably damaging Het
Trpv3 A T 11: 73,297,187 E788V probably damaging Het
Ttn A G 2: 76,745,519 I25010T probably damaging Het
Ube2ql1 T C 13: 69,739,300 H14R unknown Het
Uggt1 C T 1: 36,195,971 R419H probably benign Het
Xpo4 A G 14: 57,613,274 V391A probably benign Het
Zfhx3 A G 8: 108,794,187 D647G probably damaging Het
Zfp354c A T 11: 50,815,630 M206K probably benign Het
Zfp804a A G 2: 82,258,920 N1031S possibly damaging Het
Zfp868 A G 8: 69,612,231 V151A probably benign Het
Other mutations in Olfr1158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1158 APN 2 87990438 missense probably damaging 1.00
IGL01287:Olfr1158 APN 2 87990944 missense probably benign 0.01
IGL01374:Olfr1158 APN 2 87990548 missense probably benign
IGL01821:Olfr1158 APN 2 87990589 missense probably benign 0.12
IGL01832:Olfr1158 APN 2 87990169 missense probably benign 0.02
IGL02327:Olfr1158 APN 2 87990257 missense probably damaging 1.00
IGL02580:Olfr1158 APN 2 87990513 missense probably benign 0.09
IGL03001:Olfr1158 APN 2 87990149 missense probably benign 0.43
IGL03196:Olfr1158 APN 2 87990482 missense possibly damaging 0.67
R1474:Olfr1158 UTSW 2 87990990 missense probably damaging 1.00
R1650:Olfr1158 UTSW 2 87990801 missense probably benign 0.01
R1757:Olfr1158 UTSW 2 87990582 missense probably damaging 0.99
R2992:Olfr1158 UTSW 2 87990777 missense probably benign 0.00
R4038:Olfr1158 UTSW 2 87990918 missense possibly damaging 0.88
R5190:Olfr1158 UTSW 2 87990763 nonsense probably null
R5871:Olfr1158 UTSW 2 87991011 missense possibly damaging 0.82
R8220:Olfr1158 UTSW 2 87990152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAGAGTCTCCTATTTGCTGTG -3'
(R):5'- ACAGACAGCTTCCACCAAACTTGTG -3'

Sequencing Primer
(F):5'- GATTGTATTGATCACAGTCAGTCC -3'
(R):5'- GTCATGTGTGTAAGTATCAAAGCAG -3'
Posted On2013-06-11