Incidental Mutation 'R5787:Cyp11a1'
ID448090
Institutional Source Beutler Lab
Gene Symbol Cyp11a1
Ensembl Gene ENSMUSG00000032323
Gene Namecytochrome P450, family 11, subfamily a, polypeptide 1
SynonymsCyp11a, cholesterol side chain cleavage, Scc, cscc, D9Ertd411e, P450scc
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58006411-58027023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58015267 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 77 (Q77K)
Ref Sequence ENSEMBL: ENSMUSP00000034874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000188116] [ENSMUST00000188539]
Predicted Effect probably benign
Transcript: ENSMUST00000034874
AA Change: Q77K

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323
AA Change: Q77K

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188116
SMART Domains Protein: ENSMUSP00000140545
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 32 115 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188539
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188944
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are exhibit a steroid deficiency and die within days of birth showing signs of dehydration. Males are feminized with female external genitalia and underdeveloped gonads. Mice homozgyous for another knock-out allele exhibit abnormal adrenal development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Cyp11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Cyp11a1 APN 9 58019313 missense probably damaging 1.00
IGL01122:Cyp11a1 APN 9 58016306 missense probably damaging 1.00
IGL01993:Cyp11a1 APN 9 58020823 missense probably damaging 1.00
PIT4431001:Cyp11a1 UTSW 9 58016272 critical splice acceptor site probably null
R0347:Cyp11a1 UTSW 9 58016260 unclassified probably benign
R1446:Cyp11a1 UTSW 9 58015277 missense possibly damaging 0.95
R1774:Cyp11a1 UTSW 9 58018360 missense probably benign 0.05
R1918:Cyp11a1 UTSW 9 58026757 missense probably damaging 1.00
R2935:Cyp11a1 UTSW 9 58016390 missense probably damaging 1.00
R3724:Cyp11a1 UTSW 9 58019322 missense probably benign 0.00
R4866:Cyp11a1 UTSW 9 58026097 missense probably damaging 1.00
R5301:Cyp11a1 UTSW 9 58019261 intron probably benign
R5718:Cyp11a1 UTSW 9 58018225 missense probably benign 0.00
R5988:Cyp11a1 UTSW 9 58020834 missense probably benign 0.01
R6044:Cyp11a1 UTSW 9 58026704 missense probably damaging 1.00
R6286:Cyp11a1 UTSW 9 58017418 intron probably benign
R6306:Cyp11a1 UTSW 9 58025100 missense probably benign 0.00
R6325:Cyp11a1 UTSW 9 58025568 missense probably benign
R6826:Cyp11a1 UTSW 9 58025087 missense probably damaging 0.97
R6931:Cyp11a1 UTSW 9 58025120 missense possibly damaging 0.77
R6960:Cyp11a1 UTSW 9 58018376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGCTGCCAACCTTTCC -3'
(R):5'- TGCTCACACTTCTTTATACCAGTAG -3'

Sequencing Primer
(F):5'- TTCCTGAGCCCTACGTGG -3'
(R):5'- TACCAGTAGAAAAAGTCTTGGAGTC -3'
Posted On2016-12-15