Incidental Mutation 'R5787:Pdlim4'
ID 448095
Institutional Source Beutler Lab
Gene Symbol Pdlim4
Ensembl Gene ENSMUSG00000020388
Gene Name PDZ and LIM domain 4
Synonyms Ril
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R5787 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 54054928-54069014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54055216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 271 (D271V)
Ref Sequence ENSEMBL: ENSMUSP00000018755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018755] [ENSMUST00000093109] [ENSMUST00000144477]
AlphaFold P70271
Predicted Effect probably damaging
Transcript: ENSMUST00000018755
AA Change: D271V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018755
Gene: ENSMUSG00000020388
AA Change: D271V

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Pfam:DUF4749 142 230 7.2e-14 PFAM
LIM 254 305 9.75e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093109
AA Change: T232S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090797
Gene: ENSMUSG00000020388
AA Change: T232S

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127271
Predicted Effect probably benign
Transcript: ENSMUST00000144477
SMART Domains Protein: ENSMUSP00000121248
Gene: ENSMUSG00000020388

DomainStartEndE-ValueType
Blast:PDZ 1 25 2e-10 BLAST
SCOP:d1qava_ 1 25 3e-4 SMART
PDB:2V1W|B 1 28 2e-11 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Pdlim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Pdlim4 APN 11 54056304 missense probably benign 0.43
IGL02005:Pdlim4 APN 11 54059984 missense probably benign 0.10
IGL02305:Pdlim4 APN 11 54055933 missense probably damaging 1.00
IGL03073:Pdlim4 APN 11 54063641 missense probably damaging 1.00
BB001:Pdlim4 UTSW 11 54055222 nonsense probably null
BB011:Pdlim4 UTSW 11 54055222 nonsense probably null
R0008:Pdlim4 UTSW 11 54055049 missense probably damaging 1.00
R0612:Pdlim4 UTSW 11 54068887 missense probably damaging 1.00
R1646:Pdlim4 UTSW 11 54056254 missense possibly damaging 0.94
R1754:Pdlim4 UTSW 11 54055873 missense possibly damaging 0.82
R2132:Pdlim4 UTSW 11 54063737 missense possibly damaging 0.70
R3037:Pdlim4 UTSW 11 54056257 missense probably benign 0.15
R4210:Pdlim4 UTSW 11 54055918 missense possibly damaging 0.70
R5969:Pdlim4 UTSW 11 54063656 missense possibly damaging 0.50
R6862:Pdlim4 UTSW 11 54055848 missense probably damaging 1.00
R7924:Pdlim4 UTSW 11 54055222 nonsense probably null
R8927:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R8928:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R9026:Pdlim4 UTSW 11 54055454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACCTTAGCATTGGGGTATACAG -3'
(R):5'- CTCTGGATTTCAGGGGATCG -3'

Sequencing Primer
(F):5'- TTAGCATTGGGGTATACAGCCACC -3'
(R):5'- TCGGTGCTCCACTGAGTG -3'
Posted On 2016-12-15