Incidental Mutation 'R5787:Clcn2'
ID 448115
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms nmf240, Clc2, ClC-2
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R5787 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 20521714-20536496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20522183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 829 (R829L)
Ref Sequence ENSEMBL: ENSMUSP00000112759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000128273] [ENSMUST00000131522] [ENSMUST00000232309] [ENSMUST00000232207] [ENSMUST00000149543]
AlphaFold Q9R0A1
Predicted Effect probably damaging
Transcript: ENSMUST00000007207
AA Change: R846L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: R846L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: R829L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: R829L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123417
Predicted Effect probably benign
Transcript: ENSMUST00000128273
SMART Domains Protein: ENSMUSP00000120596
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 202 4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153075
Predicted Effect probably damaging
Transcript: ENSMUST00000232309
AA Change: R802L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000232207
Predicted Effect probably benign
Transcript: ENSMUST00000149543
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adam24 A G 8: 41,133,941 (GRCm39) N470D possibly damaging Het
Adcy8 T C 15: 64,576,067 (GRCm39) D1027G probably damaging Het
Amph A T 13: 19,132,624 (GRCm39) I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Ano5 G A 7: 51,216,066 (GRCm39) D348N possibly damaging Het
Atp6v0a1 A G 11: 100,909,400 (GRCm39) D43G probably benign Het
Bltp1 T C 3: 37,046,882 (GRCm39) probably null Het
Btnl10 T A 11: 58,811,169 (GRCm39) I164N probably damaging Het
Ccdc174 C T 6: 91,858,291 (GRCm39) Q71* probably null Het
Ceacam3 G A 7: 16,888,971 (GRCm39) E247K possibly damaging Het
Chrna2 A G 14: 66,386,457 (GRCm39) D201G probably benign Het
Clasp2 G A 9: 113,691,310 (GRCm39) D448N probably damaging Het
Clock A G 5: 76,384,898 (GRCm39) S440P probably damaging Het
Cntn2 T C 1: 132,450,797 (GRCm39) D29G probably damaging Het
Cpne4 A G 9: 104,899,600 (GRCm39) T428A probably benign Het
Cul3 T C 1: 80,260,438 (GRCm39) I304V probably benign Het
Cyp11a1 C A 9: 57,922,550 (GRCm39) Q77K probably benign Het
Cyp3a25 A G 5: 145,935,313 (GRCm39) V101A probably benign Het
Cyp4f15 T C 17: 32,921,782 (GRCm39) F485L probably damaging Het
Des T A 1: 75,340,290 (GRCm39) V399E probably damaging Het
Dhx58 T C 11: 100,592,145 (GRCm39) D301G possibly damaging Het
Ear6 A G 14: 52,091,855 (GRCm39) E134G probably benign Het
Eif2b3 A G 4: 116,901,637 (GRCm39) D100G probably damaging Het
Erich1 T C 8: 14,083,776 (GRCm39) probably null Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Htr4 T C 18: 62,546,693 (GRCm39) V82A probably damaging Het
Hydin A G 8: 111,052,985 (GRCm39) D219G probably damaging Het
Ifit1 T A 19: 34,624,975 (GRCm39) V37E probably benign Het
Isg20 T A 7: 78,569,558 (GRCm39) D176E probably benign Het
Islr2 A G 9: 58,105,637 (GRCm39) V585A probably damaging Het
Kat6a A G 8: 23,422,663 (GRCm39) E991G probably damaging Het
Kcnv1 T C 15: 44,977,726 (GRCm39) Y104C probably damaging Het
Lrtm1 G C 14: 28,743,947 (GRCm39) E138D possibly damaging Het
Mllt3 A T 4: 87,759,057 (GRCm39) D330E probably damaging Het
Mpp7 T C 18: 7,461,682 (GRCm39) N64D probably benign Het
Naip6 G T 13: 100,436,724 (GRCm39) Q600K probably benign Het
Nop9 T G 14: 55,983,791 (GRCm39) C141G possibly damaging Het
Nos1ap T C 1: 170,146,141 (GRCm39) E471G probably benign Het
Npr2 A G 4: 43,633,593 (GRCm39) T246A possibly damaging Het
Or2t1 A C 14: 14,328,725 (GRCm38) M205L probably damaging Het
Or4a76 T A 2: 89,461,018 (GRCm39) I75F probably benign Het
Or6z1 A T 7: 6,504,989 (GRCm39) S79T probably damaging Het
Pdlim4 T A 11: 53,946,042 (GRCm39) D271V probably damaging Het
Pik3r6 T C 11: 68,430,753 (GRCm39) V518A possibly damaging Het
Rab5a C T 17: 53,804,650 (GRCm39) P87S probably damaging Het
Rbsn C T 6: 92,176,797 (GRCm39) V239I possibly damaging Het
Rsph14 T A 10: 74,793,460 (GRCm39) I314F possibly damaging Het
S1pr2 A T 9: 20,879,232 (GRCm39) S199T probably benign Het
Scrib A G 15: 75,931,151 (GRCm39) L902P probably damaging Het
Slc25a23 T C 17: 57,360,825 (GRCm39) T200A probably damaging Het
Slc8a1 A T 17: 81,696,166 (GRCm39) I956N probably damaging Het
Spef2 A G 15: 9,748,812 (GRCm39) V15A possibly damaging Het
Stim1 T A 7: 102,084,647 (GRCm39) V533E possibly damaging Het
Tbck A T 3: 132,443,329 (GRCm39) D585V probably damaging Het
Tpr T A 1: 150,271,037 (GRCm39) L80Q probably benign Het
Trim67 C T 8: 125,521,051 (GRCm39) R138* probably null Het
Ttn T C 2: 76,580,627 (GRCm39) N23422S probably damaging Het
Uba6 A G 5: 86,260,511 (GRCm39) *1023Q probably null Het
Vmn1r208 T C 13: 22,956,841 (GRCm39) N219D possibly damaging Het
Vmn1r8 T A 6: 57,013,244 (GRCm39) S98R probably damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20,522,391 (GRCm39) missense probably benign 0.08
IGL01657:Clcn2 APN 16 20,532,369 (GRCm39) missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20,531,511 (GRCm39) missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20,527,214 (GRCm39) missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20,522,098 (GRCm39) missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20,528,006 (GRCm39) nonsense probably null
IGL03329:Clcn2 APN 16 20,530,902 (GRCm39) missense probably damaging 1.00
Bemr14 UTSW 16 0 () unclassified
R0008:Clcn2 UTSW 16 20,529,140 (GRCm39) missense probably null 1.00
R0454:Clcn2 UTSW 16 20,529,178 (GRCm39) critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20,522,345 (GRCm39) missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20,531,302 (GRCm39) splice site probably benign
R1824:Clcn2 UTSW 16 20,534,712 (GRCm39) missense probably benign 0.04
R4592:Clcn2 UTSW 16 20,527,892 (GRCm39) missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20,522,053 (GRCm39) missense probably benign 0.01
R5374:Clcn2 UTSW 16 20,528,419 (GRCm39) missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20,529,285 (GRCm39) intron probably benign
R5992:Clcn2 UTSW 16 20,532,404 (GRCm39) missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20,530,438 (GRCm39) critical splice donor site probably null
R6663:Clcn2 UTSW 16 20,521,995 (GRCm39) makesense probably null
R6765:Clcn2 UTSW 16 20,526,418 (GRCm39) splice site probably null
R6825:Clcn2 UTSW 16 20,528,408 (GRCm39) utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20,527,210 (GRCm39) missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20,527,512 (GRCm39) missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20,525,946 (GRCm39) missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20,532,168 (GRCm39) missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20,530,930 (GRCm39) missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20,531,080 (GRCm39) missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20,531,414 (GRCm39) missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20,525,979 (GRCm39) missense probably benign 0.00
R9456:Clcn2 UTSW 16 20,534,702 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGGTTCACTGGCACTTG -3'
(R):5'- ACCATCTTCTCATTGCTGGG -3'

Sequencing Primer
(F):5'- CACTTGTCATCACTGTCGGAGG -3'
(R):5'- AGTGGACCATGCTTATGTCACCAG -3'
Posted On 2016-12-15