Mutagenetix > Incidental Mutation

Incidental Mutation 'R5787:Mpp7'

448120

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R5787 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7461682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 64 (N64D)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115869
AA Change: N64D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: N64D

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,992,733		probably null	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Adam24	A	G	8: 40,680,902	N470D	possibly damaging	Het
Adcy8	T	C	15: 64,704,218	D1027G	probably damaging	Het
Amph	A	T	13: 18,948,454	I8F	possibly damaging	Het
Ankrd60	TGGCCACGCGG	TGG	2: 173,578,089		probably null	Het
Ano5	G	A	7: 51,566,318	D348N	possibly damaging	Het
Atp6v0a1	A	G	11: 101,018,574	D43G	probably benign	Het
Btnl10	T	A	11: 58,920,343	I164N	probably damaging	Het
Ccdc174	C	T	6: 91,881,310	Q71*	probably null	Het
Ceacam3	G	A	7: 17,155,046	E247K	possibly damaging	Het
Chrna2	A	G	14: 66,149,008	D201G	probably benign	Het
Clasp2	G	A	9: 113,862,242	D448N	probably damaging	Het
Clcn2	C	A	16: 20,703,433	R829L	probably damaging	Het
Clock	A	G	5: 76,237,051	S440P	probably damaging	Het
Cntn2	T	C	1: 132,523,059	D29G	probably damaging	Het
Cpne4	A	G	9: 105,022,401	T428A	probably benign	Het
Cul3	T	C	1: 80,282,721	I304V	probably benign	Het
Cyp11a1	C	A	9: 58,015,267	Q77K	probably benign	Het
Cyp3a25	A	G	5: 145,998,503	V101A	probably benign	Het
Cyp4f15	T	C	17: 32,702,808	F485L	probably damaging	Het
Des	T	A	1: 75,363,646	V399E	probably damaging	Het
Dhx58	T	C	11: 100,701,319	D301G	possibly damaging	Het
Ear6	A	G	14: 51,854,398	E134G	probably benign	Het
Eif2b3	A	G	4: 117,044,440	D100G	probably damaging	Het
Erich1	T	C	8: 14,033,776		probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Htr4	T	C	18: 62,413,622	V82A	probably damaging	Het
Hydin	A	G	8: 110,326,353	D219G	probably damaging	Het
Ifit1	T	A	19: 34,647,575	V37E	probably benign	Het
Isg20	T	A	7: 78,919,810	D176E	probably benign	Het
Islr2	A	G	9: 58,198,354	V585A	probably damaging	Het
Kat6a	A	G	8: 22,932,647	E991G	probably damaging	Het
Kcnv1	T	C	15: 45,114,330	Y104C	probably damaging	Het
Lrtm1	G	C	14: 29,021,990	E138D	possibly damaging	Het
Mllt3	A	T	4: 87,840,820	D330E	probably damaging	Het
Naip6	G	T	13: 100,300,216	Q600K	probably benign	Het
Nop9	T	G	14: 55,746,334	C141G	possibly damaging	Het
Nos1ap	T	C	1: 170,318,572	E471G	probably benign	Het
Npr2	A	G	4: 43,633,593	T246A	possibly damaging	Het
Olfr1249	T	A	2: 89,630,674	I75F	probably benign	Het
Olfr1348	A	T	7: 6,501,990	S79T	probably damaging	Het
Olfr31	A	C	14: 14,328,725	M205L	probably damaging	Het
Pdlim4	T	A	11: 54,055,216	D271V	probably damaging	Het
Pik3r6	T	C	11: 68,539,927	V518A	possibly damaging	Het
Rab5a	C	T	17: 53,497,622	P87S	probably damaging	Het
Rbsn	C	T	6: 92,199,816	V239I	possibly damaging	Het
Rsph14	T	A	10: 74,957,628	I314F	possibly damaging	Het
S1pr2	A	T	9: 20,967,936	S199T	probably benign	Het
Scrib	A	G	15: 76,059,302	L902P	probably damaging	Het
Slc25a23	T	C	17: 57,053,825	T200A	probably damaging	Het
Slc8a1	A	T	17: 81,388,737	I956N	probably damaging	Het
Spef2	A	G	15: 9,748,726	V15A	possibly damaging	Het
Stim1	T	A	7: 102,435,440	V533E	possibly damaging	Het
Tbck	A	T	3: 132,737,568	D585V	probably damaging	Het
Tpr	T	A	1: 150,395,286	L80Q	probably benign	Het
Trim67	C	T	8: 124,794,312	R138*	probably null	Het
Ttn	T	C	2: 76,750,283	N23422S	probably damaging	Het
Uba6	A	G	5: 86,112,652	*1023Q	probably null	Het
Vmn1r208	T	C	13: 22,772,671	N219D	possibly damaging	Het
Vmn1r8	T	A	6: 57,036,259	S98R	probably damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACAAGCGTGGTGATGACAG -3'
(R):5'- TCTGTCTGAAGAAAGTTTTGCC -3'

Sequencing Primer
(F):5'- CAGAGATTTGGGAAACATTTGCAAC -3'
(R):5'- GATGGATTGCATATACATGTCTGCC -3'

Posted On

2016-12-15