Incidental Mutation 'R5788:Uchl1'
ID 448138
Institutional Source Beutler Lab
Gene Symbol Uchl1
Ensembl Gene ENSMUSG00000029223
Gene Name ubiquitin carboxy-terminal hydrolase L1
Synonyms PGP 9.5, PGP9.5
MMRRC Submission 043382-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5788 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 66833464-66844577 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 66833754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031131]
AlphaFold Q9R0P9
Predicted Effect probably benign
Transcript: ENSMUST00000031131
SMART Domains Protein: ENSMUSP00000031131
Gene: ENSMUSG00000029223

DomainStartEndE-ValueType
Pfam:Peptidase_C12 3 206 3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177319
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for one allele show ataxia beginning at 80 days of age, followed by progressive tremors, impaired locomotion, atrophy of hind limb muscles, and death by 5-6 months. Mice homozygous for a second allele exhibit defects in motor coordinationand decreases in thermal pain sensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,045,328 (GRCm39) Y420C probably benign Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Amfr T A 8: 94,726,942 (GRCm39) R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Ano5 G A 7: 51,216,066 (GRCm39) D348N possibly damaging Het
Atp8a2 T A 14: 60,258,242 (GRCm39) D440V probably damaging Het
Bahcc1 A G 11: 120,177,178 (GRCm39) D2022G probably damaging Het
Bicd1 T C 6: 149,385,498 (GRCm39) F77S probably benign Het
Ccdc66 C T 14: 27,220,448 (GRCm39) R255H probably benign Het
Ckm A G 7: 19,153,372 (GRCm39) D152G probably benign Het
Cpsf7 T G 19: 10,518,082 (GRCm39) S431A possibly damaging Het
Csmd1 T C 8: 16,251,980 (GRCm39) T959A probably damaging Het
Dkk4 T C 8: 23,115,347 (GRCm39) C66R probably damaging Het
Espl1 T A 15: 102,232,465 (GRCm39) W2058R probably damaging Het
Evi5l A T 8: 4,256,800 (GRCm39) probably benign Het
Fancg A T 4: 43,007,130 (GRCm39) probably benign Het
Flg2 A T 3: 93,108,296 (GRCm39) H108L probably benign Het
Fzd2 A T 11: 102,496,293 (GRCm39) T246S probably benign Het
Gm10428 T G 11: 62,644,107 (GRCm39) probably benign Het
Gm1988 T A 7: 38,821,627 (GRCm39) noncoding transcript Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gm7133 A T 1: 97,171,201 (GRCm39) noncoding transcript Het
Grin2b T C 6: 135,717,962 (GRCm39) N710S probably benign Het
Hcn2 T C 10: 79,552,945 (GRCm39) V148A possibly damaging Het
Hephl1 A G 9: 14,995,579 (GRCm39) L483S possibly damaging Het
Hinfp C T 9: 44,209,105 (GRCm39) E338K possibly damaging Het
Hsd17b4 G A 18: 50,306,776 (GRCm39) D494N probably damaging Het
Ipo4 C T 14: 55,866,277 (GRCm39) V801M probably benign Het
Kcns2 A C 15: 34,839,000 (GRCm39) Y121S probably benign Het
Kif1c T A 11: 70,599,654 (GRCm39) L462H probably damaging Het
Lrrk2 T G 15: 91,648,851 (GRCm39) V1615G possibly damaging Het
Naca G A 10: 127,876,011 (GRCm39) probably benign Het
Naip6 G T 13: 100,436,724 (GRCm39) Q600K probably benign Het
Ndufs2 A G 1: 171,066,954 (GRCm39) Y135H probably damaging Het
Nwd2 T C 5: 63,965,114 (GRCm39) V1566A probably benign Het
Or52d13 C T 7: 103,110,086 (GRCm39) V110I possibly damaging Het
Or52n4b T C 7: 108,144,551 (GRCm39) I271T probably damaging Het
Or5t17 A G 2: 86,832,645 (GRCm39) T111A probably benign Het
Or6c75 A G 10: 129,336,779 (GRCm39) M1V probably null Het
Or6c75 A T 10: 129,336,763 (GRCm39) L3F probably benign Het
Pcid2 C T 8: 13,150,320 (GRCm39) probably null Het
Pld4 A C 12: 112,730,551 (GRCm39) I145L probably benign Het
Pogk A T 1: 166,236,580 (GRCm39) probably benign Het
Rhbg C T 3: 88,152,874 (GRCm39) V280I probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rxfp3 A G 15: 11,036,250 (GRCm39) F374S possibly damaging Het
Son A G 16: 91,456,940 (GRCm39) probably benign Het
Specc1l G T 10: 75,112,755 (GRCm39) R994L probably damaging Het
Tas2r135 T A 6: 42,382,531 (GRCm39) D23E probably damaging Het
Teddm2 A T 1: 153,726,810 (GRCm39) H21Q probably benign Het
Tet1 T C 10: 62,675,737 (GRCm39) T780A possibly damaging Het
Thbs1 T A 2: 117,952,989 (GRCm39) D866E probably damaging Het
Tmed4 A G 11: 6,221,743 (GRCm39) W198R probably damaging Het
Ttn A T 2: 76,749,575 (GRCm39) C3825S probably benign Het
Wsb2 A G 5: 117,515,483 (GRCm39) T363A possibly damaging Het
Zfp266 A G 9: 20,417,332 (GRCm39) Y19H probably damaging Het
Zkscan17 A G 11: 59,378,086 (GRCm39) C366R probably damaging Het
Other mutations in Uchl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02179:Uchl1 APN 5 66,833,637 (GRCm39) missense probably benign 0.24
IGL02186:Uchl1 APN 5 66,834,382 (GRCm39) nonsense probably null
IGL03268:Uchl1 APN 5 66,839,824 (GRCm39) missense probably benign 0.03
R0556:Uchl1 UTSW 5 66,839,824 (GRCm39) missense probably benign 0.06
R1075:Uchl1 UTSW 5 66,839,808 (GRCm39) missense probably damaging 1.00
R1736:Uchl1 UTSW 5 66,834,417 (GRCm39) critical splice donor site probably null
R2516:Uchl1 UTSW 5 66,839,956 (GRCm39) missense probably damaging 1.00
R4888:Uchl1 UTSW 5 66,833,780 (GRCm39) missense probably benign 0.32
R5121:Uchl1 UTSW 5 66,833,780 (GRCm39) missense probably benign 0.32
R5569:Uchl1 UTSW 5 66,844,216 (GRCm39) missense probably damaging 0.99
R6881:Uchl1 UTSW 5 66,841,065 (GRCm39) missense probably damaging 0.99
R6990:Uchl1 UTSW 5 66,839,818 (GRCm39) missense possibly damaging 0.86
R8807:Uchl1 UTSW 5 66,833,601 (GRCm39) start gained probably benign
R9364:Uchl1 UTSW 5 66,833,649 (GRCm39) missense probably damaging 1.00
R9554:Uchl1 UTSW 5 66,833,649 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTTATAACAGCAGCCTGG -3'
(R):5'- GTGATCGATCTCTCAGTCACTC -3'

Sequencing Primer
(F):5'- TTAACCCCGAGGTAAGCA -3'
(R):5'- GATCGATCTCTCAGTCACTCCCAAAC -3'
Posted On 2016-12-15