Incidental Mutation 'R5788:Lrrk2'
ID 448180
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026
MMRRC Submission 043382-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R5788 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91557378-91700323 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 91648851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 1615 (V1615G)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect possibly damaging
Transcript: ENSMUST00000060642
AA Change: V1615G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: V1615G

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,045,328 (GRCm39) Y420C probably benign Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Amfr T A 8: 94,726,942 (GRCm39) R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Ano5 G A 7: 51,216,066 (GRCm39) D348N possibly damaging Het
Atp8a2 T A 14: 60,258,242 (GRCm39) D440V probably damaging Het
Bahcc1 A G 11: 120,177,178 (GRCm39) D2022G probably damaging Het
Bicd1 T C 6: 149,385,498 (GRCm39) F77S probably benign Het
Ccdc66 C T 14: 27,220,448 (GRCm39) R255H probably benign Het
Ckm A G 7: 19,153,372 (GRCm39) D152G probably benign Het
Cpsf7 T G 19: 10,518,082 (GRCm39) S431A possibly damaging Het
Csmd1 T C 8: 16,251,980 (GRCm39) T959A probably damaging Het
Dkk4 T C 8: 23,115,347 (GRCm39) C66R probably damaging Het
Espl1 T A 15: 102,232,465 (GRCm39) W2058R probably damaging Het
Evi5l A T 8: 4,256,800 (GRCm39) probably benign Het
Fancg A T 4: 43,007,130 (GRCm39) probably benign Het
Flg2 A T 3: 93,108,296 (GRCm39) H108L probably benign Het
Fzd2 A T 11: 102,496,293 (GRCm39) T246S probably benign Het
Gm10428 T G 11: 62,644,107 (GRCm39) probably benign Het
Gm1988 T A 7: 38,821,627 (GRCm39) noncoding transcript Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gm7133 A T 1: 97,171,201 (GRCm39) noncoding transcript Het
Grin2b T C 6: 135,717,962 (GRCm39) N710S probably benign Het
Hcn2 T C 10: 79,552,945 (GRCm39) V148A possibly damaging Het
Hephl1 A G 9: 14,995,579 (GRCm39) L483S possibly damaging Het
Hinfp C T 9: 44,209,105 (GRCm39) E338K possibly damaging Het
Hsd17b4 G A 18: 50,306,776 (GRCm39) D494N probably damaging Het
Ipo4 C T 14: 55,866,277 (GRCm39) V801M probably benign Het
Kcns2 A C 15: 34,839,000 (GRCm39) Y121S probably benign Het
Kif1c T A 11: 70,599,654 (GRCm39) L462H probably damaging Het
Naca G A 10: 127,876,011 (GRCm39) probably benign Het
Naip6 G T 13: 100,436,724 (GRCm39) Q600K probably benign Het
Ndufs2 A G 1: 171,066,954 (GRCm39) Y135H probably damaging Het
Nwd2 T C 5: 63,965,114 (GRCm39) V1566A probably benign Het
Or52d13 C T 7: 103,110,086 (GRCm39) V110I possibly damaging Het
Or52n4b T C 7: 108,144,551 (GRCm39) I271T probably damaging Het
Or5t17 A G 2: 86,832,645 (GRCm39) T111A probably benign Het
Or6c75 A G 10: 129,336,779 (GRCm39) M1V probably null Het
Or6c75 A T 10: 129,336,763 (GRCm39) L3F probably benign Het
Pcid2 C T 8: 13,150,320 (GRCm39) probably null Het
Pld4 A C 12: 112,730,551 (GRCm39) I145L probably benign Het
Pogk A T 1: 166,236,580 (GRCm39) probably benign Het
Rhbg C T 3: 88,152,874 (GRCm39) V280I probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rxfp3 A G 15: 11,036,250 (GRCm39) F374S possibly damaging Het
Son A G 16: 91,456,940 (GRCm39) probably benign Het
Specc1l G T 10: 75,112,755 (GRCm39) R994L probably damaging Het
Tas2r135 T A 6: 42,382,531 (GRCm39) D23E probably damaging Het
Teddm2 A T 1: 153,726,810 (GRCm39) H21Q probably benign Het
Tet1 T C 10: 62,675,737 (GRCm39) T780A possibly damaging Het
Thbs1 T A 2: 117,952,989 (GRCm39) D866E probably damaging Het
Tmed4 A G 11: 6,221,743 (GRCm39) W198R probably damaging Het
Ttn A T 2: 76,749,575 (GRCm39) C3825S probably benign Het
Uchl1 T A 5: 66,833,754 (GRCm39) probably benign Het
Wsb2 A G 5: 117,515,483 (GRCm39) T363A possibly damaging Het
Zfp266 A G 9: 20,417,332 (GRCm39) Y19H probably damaging Het
Zkscan17 A G 11: 59,378,086 (GRCm39) C366R probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,632,002 (GRCm39) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,584,146 (GRCm39) missense probably benign
IGL00770:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00774:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00791:Lrrk2 APN 15 91,664,044 (GRCm39) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,639,993 (GRCm39) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,641,261 (GRCm39) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,623,035 (GRCm39) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,610,340 (GRCm39) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,567,345 (GRCm39) missense probably benign
IGL01301:Lrrk2 APN 15 91,651,542 (GRCm39) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,584,772 (GRCm39) splice site probably null
IGL01465:Lrrk2 APN 15 91,613,128 (GRCm39) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,696,516 (GRCm39) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,584,192 (GRCm39) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,659,191 (GRCm39) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,664,149 (GRCm39) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,615,694 (GRCm39) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,610,511 (GRCm39) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,570,025 (GRCm39) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,634,480 (GRCm39) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,631,958 (GRCm39) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,584,781 (GRCm39) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,681,617 (GRCm39) splice site probably null
horned UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
spree UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
Spur UTSW 15 91,659,198 (GRCm39) nonsense probably null
3-1:Lrrk2 UTSW 15 91,686,137 (GRCm39) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,651,542 (GRCm39) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
H8786:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
IGL02835:Lrrk2 UTSW 15 91,698,863 (GRCm39) critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0078:Lrrk2 UTSW 15 91,618,212 (GRCm39) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,629,999 (GRCm39) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,662,617 (GRCm39) splice site probably benign
R0448:Lrrk2 UTSW 15 91,593,508 (GRCm39) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,634,478 (GRCm39) missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91,699,619 (GRCm39) missense probably benign
R0617:Lrrk2 UTSW 15 91,636,481 (GRCm39) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,680,231 (GRCm39) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,657,199 (GRCm39) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,641,273 (GRCm39) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,659,249 (GRCm39) splice site probably null
R0766:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,640,165 (GRCm39) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,613,284 (GRCm39) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,613,372 (GRCm39) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,557,892 (GRCm39) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,584,671 (GRCm39) nonsense probably null
R1223:Lrrk2 UTSW 15 91,557,838 (GRCm39) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,696,563 (GRCm39) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,613,123 (GRCm39) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,618,261 (GRCm39) missense probably benign
R1773:Lrrk2 UTSW 15 91,664,184 (GRCm39) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,584,095 (GRCm39) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,567,337 (GRCm39) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,620,864 (GRCm39) splice site probably null
R2160:Lrrk2 UTSW 15 91,680,263 (GRCm39) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,648,919 (GRCm39) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,681,729 (GRCm39) splice site probably benign
R2516:Lrrk2 UTSW 15 91,640,130 (GRCm39) missense probably benign
R3110:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,621,314 (GRCm39) missense probably benign
R3842:Lrrk2 UTSW 15 91,640,119 (GRCm39) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,631,904 (GRCm39) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,631,903 (GRCm39) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,651,664 (GRCm39) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,596,983 (GRCm39) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,593,487 (GRCm39) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,699,686 (GRCm39) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,639,997 (GRCm39) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,632,023 (GRCm39) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,607,391 (GRCm39) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,589,323 (GRCm39) missense probably benign
R4539:Lrrk2 UTSW 15 91,613,345 (GRCm39) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,573,104 (GRCm39) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,648,962 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,597,031 (GRCm39) missense probably benign
R4945:Lrrk2 UTSW 15 91,689,123 (GRCm39) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,687,592 (GRCm39) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,634,081 (GRCm39) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,584,822 (GRCm39) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,649,993 (GRCm39) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,698,847 (GRCm39) splice site probably null
R5551:Lrrk2 UTSW 15 91,696,553 (GRCm39) missense probably benign
R5574:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,649,948 (GRCm39) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,687,504 (GRCm39) nonsense probably null
R5712:Lrrk2 UTSW 15 91,586,425 (GRCm39) nonsense probably null
R5728:Lrrk2 UTSW 15 91,659,177 (GRCm39) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,586,386 (GRCm39) missense probably damaging 1.00
R5821:Lrrk2 UTSW 15 91,593,593 (GRCm39) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,640,152 (GRCm39) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,618,249 (GRCm39) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,630,034 (GRCm39) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,657,148 (GRCm39) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,607,338 (GRCm39) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,632,029 (GRCm39) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,626,469 (GRCm39) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,607,421 (GRCm39) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,659,198 (GRCm39) nonsense probably null
R7072:Lrrk2 UTSW 15 91,686,123 (GRCm39) missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91,648,985 (GRCm39) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,686,088 (GRCm39) missense probably benign
R7144:Lrrk2 UTSW 15 91,618,258 (GRCm39) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,641,204 (GRCm39) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,584,644 (GRCm39) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,622,947 (GRCm39) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,615,858 (GRCm39) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,584,207 (GRCm39) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,651,543 (GRCm39) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,696,528 (GRCm39) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,696,526 (GRCm39) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,584,561 (GRCm39) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,610,389 (GRCm39) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,699,649 (GRCm39) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,584,816 (GRCm39) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,651,527 (GRCm39) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,610,355 (GRCm39) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,557,443 (GRCm39) start gained probably benign
R8389:Lrrk2 UTSW 15 91,584,194 (GRCm39) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,615,680 (GRCm39) missense probably benign
R8698:Lrrk2 UTSW 15 91,636,400 (GRCm39) missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91,586,473 (GRCm39) nonsense probably null
R9084:Lrrk2 UTSW 15 91,634,469 (GRCm39) missense
R9086:Lrrk2 UTSW 15 91,640,051 (GRCm39) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9097:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9267:Lrrk2 UTSW 15 91,584,629 (GRCm39) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,662,686 (GRCm39) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,607,407 (GRCm39) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9489:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91,607,365 (GRCm39) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,634,043 (GRCm39) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9605:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,696,527 (GRCm39) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,671,251 (GRCm39) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,634,482 (GRCm39) nonsense probably null
R9728:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,695,229 (GRCm39) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,620,836 (GRCm39) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,623,054 (GRCm39) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,610,443 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGAATGTATAGGAATATGCCTGTGATG -3'
(R):5'- AAGGTCTGTCTTACCTGCTTG -3'

Sequencing Primer
(F):5'- TGCCTGTGATGAGACTATAGAATG -3'
(R):5'- GTCTTACCTGCTTGGAACCAGAAG -3'
Posted On 2016-12-15