Mutagenetix > Incidental Mutation

Incidental Mutation 'R5788:Espl1'

448181

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

043382-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102324030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 2058 (W2058R)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: W2058R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: W2058R

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168805

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: W2058R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.9679

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	A	G	7: 131,443,599	Y420C	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Amfr	T	A	8: 94,000,314	R90S	probably damaging	Het
Ankrd60	TGGCCACGCGG	TGG	2: 173,578,089		probably null	Het
Ano5	G	A	7: 51,566,318	D348N	possibly damaging	Het
Atp8a2	T	A	14: 60,020,793	D440V	probably damaging	Het
Bahcc1	A	G	11: 120,286,352	D2022G	probably damaging	Het
Bicd1	T	C	6: 149,484,000	F77S	probably benign	Het
Ccdc66	C	T	14: 27,498,491	R255H	probably benign	Het
Ckm	A	G	7: 19,419,447	D152G	probably benign	Het
Cpsf7	T	G	19: 10,540,718	S431A	possibly damaging	Het
Csmd1	T	C	8: 16,201,966	T959A	probably damaging	Het
Dkk4	T	C	8: 22,625,331	C66R	probably damaging	Het
Evi5l	A	T	8: 4,206,800		probably benign	Het
Fancg	A	T	4: 43,007,130		probably benign	Het
Flg2	A	T	3: 93,200,989	H108L	probably benign	Het
Fzd2	A	T	11: 102,605,467	T246S	probably benign	Het
Gm10428	T	G	11: 62,753,281		probably benign	Het
Gm1988	T	A	7: 39,172,203		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7133	A	T	1: 97,243,476		noncoding transcript	Het
Grin2b	T	C	6: 135,740,964	N710S	probably benign	Het
Hcn2	T	C	10: 79,717,111	V148A	possibly damaging	Het
Hephl1	A	G	9: 15,084,283	L483S	possibly damaging	Het
Hinfp	C	T	9: 44,297,808	E338K	possibly damaging	Het
Hsd17b4	G	A	18: 50,173,709	D494N	probably damaging	Het
Ipo4	C	T	14: 55,628,820	V801M	probably benign	Het
Kcns2	A	C	15: 34,838,854	Y121S	probably benign	Het
Kif1c	T	A	11: 70,708,828	L462H	probably damaging	Het
Lrrk2	T	G	15: 91,764,648	V1615G	possibly damaging	Het
Naca	G	A	10: 128,040,142		probably benign	Het
Naip6	G	T	13: 100,300,216	Q600K	probably benign	Het
Ndufs2	A	G	1: 171,239,385	Y135H	probably damaging	Het
Nwd2	T	C	5: 63,807,771	V1566A	probably benign	Het
Olfr1102	A	G	2: 87,002,301	T111A	probably benign	Het
Olfr503	T	C	7: 108,545,344	I271T	probably damaging	Het
Olfr607	C	T	7: 103,460,879	V110I	possibly damaging	Het
Olfr790	A	T	10: 129,500,894	L3F	probably benign	Het
Olfr790	A	G	10: 129,500,910	M1V	probably null	Het
Pcid2	C	T	8: 13,100,320		probably null	Het
Pld4	A	C	12: 112,764,117	I145L	probably benign	Het
Pogk	A	T	1: 166,409,011		probably benign	Het
Rhbg	C	T	3: 88,245,567	V280I	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rxfp3	A	G	15: 11,036,164	F374S	possibly damaging	Het
Son	A	G	16: 91,660,052		probably benign	Het
Specc1l	G	T	10: 75,276,921	R994L	probably damaging	Het
Tas2r135	T	A	6: 42,405,597	D23E	probably damaging	Het
Teddm2	A	T	1: 153,851,064	H21Q	probably benign	Het
Tet1	T	C	10: 62,839,958	T780A	possibly damaging	Het
Thbs1	T	A	2: 118,122,508	D866E	probably damaging	Het
Tmed4	A	G	11: 6,271,743	W198R	probably damaging	Het
Ttn	A	T	2: 76,919,231	C3825S	probably benign	Het
Uchl1	T	A	5: 66,676,411		probably benign	Het
Wsb2	A	G	5: 117,377,418	T363A	possibly damaging	Het
Zfp266	A	G	9: 20,506,036	Y19H	probably damaging	Het
Zkscan17	A	G	11: 59,487,260	C366R	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGACCAACAGATGAGACCTG -3'
(R):5'- TTCAGGGTGTCTGCAGAGAG -3'

Sequencing Primer
(F):5'- ACAGATGAGACCTGCCCTCG -3'
(R):5'- TCTGCAGAGAGATAGGTAGGCC -3'

Posted On

2016-12-15