Incidental Mutation 'R5788:Hsd17b4'
ID448183
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
MMRRC Submission 043382-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R5788 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50173709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 494 (D494N)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably damaging
Transcript: ENSMUST00000025385
AA Change: D494N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: D494N

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Meta Mutation Damage Score 0.2929 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,443,599 Y420C probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Amfr T A 8: 94,000,314 R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp8a2 T A 14: 60,020,793 D440V probably damaging Het
Bahcc1 A G 11: 120,286,352 D2022G probably damaging Het
Bicd1 T C 6: 149,484,000 F77S probably benign Het
Ccdc66 C T 14: 27,498,491 R255H probably benign Het
Ckm A G 7: 19,419,447 D152G probably benign Het
Cpsf7 T G 19: 10,540,718 S431A possibly damaging Het
Csmd1 T C 8: 16,201,966 T959A probably damaging Het
Dkk4 T C 8: 22,625,331 C66R probably damaging Het
Espl1 T A 15: 102,324,030 W2058R probably damaging Het
Evi5l A T 8: 4,206,800 probably benign Het
Fancg A T 4: 43,007,130 probably benign Het
Flg2 A T 3: 93,200,989 H108L probably benign Het
Fzd2 A T 11: 102,605,467 T246S probably benign Het
Gm10428 T G 11: 62,753,281 probably benign Het
Gm1988 T A 7: 39,172,203 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7133 A T 1: 97,243,476 noncoding transcript Het
Grin2b T C 6: 135,740,964 N710S probably benign Het
Hcn2 T C 10: 79,717,111 V148A possibly damaging Het
Hephl1 A G 9: 15,084,283 L483S possibly damaging Het
Hinfp C T 9: 44,297,808 E338K possibly damaging Het
Ipo4 C T 14: 55,628,820 V801M probably benign Het
Kcns2 A C 15: 34,838,854 Y121S probably benign Het
Kif1c T A 11: 70,708,828 L462H probably damaging Het
Lrrk2 T G 15: 91,764,648 V1615G possibly damaging Het
Naca G A 10: 128,040,142 probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Ndufs2 A G 1: 171,239,385 Y135H probably damaging Het
Nwd2 T C 5: 63,807,771 V1566A probably benign Het
Olfr1102 A G 2: 87,002,301 T111A probably benign Het
Olfr503 T C 7: 108,545,344 I271T probably damaging Het
Olfr607 C T 7: 103,460,879 V110I possibly damaging Het
Olfr790 A T 10: 129,500,894 L3F probably benign Het
Olfr790 A G 10: 129,500,910 M1V probably null Het
Pcid2 C T 8: 13,100,320 probably null Het
Pld4 A C 12: 112,764,117 I145L probably benign Het
Pogk A T 1: 166,409,011 probably benign Het
Rhbg C T 3: 88,245,567 V280I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rxfp3 A G 15: 11,036,164 F374S possibly damaging Het
Son A G 16: 91,660,052 probably benign Het
Specc1l G T 10: 75,276,921 R994L probably damaging Het
Tas2r135 T A 6: 42,405,597 D23E probably damaging Het
Teddm2 A T 1: 153,851,064 H21Q probably benign Het
Tet1 T C 10: 62,839,958 T780A possibly damaging Het
Thbs1 T A 2: 118,122,508 D866E probably damaging Het
Tmed4 A G 11: 6,271,743 W198R probably damaging Het
Ttn A T 2: 76,919,231 C3825S probably benign Het
Uchl1 T A 5: 66,676,411 probably benign Het
Wsb2 A G 5: 117,377,418 T363A possibly damaging Het
Zfp266 A G 9: 20,506,036 Y19H probably damaging Het
Zkscan17 A G 11: 59,487,260 C366R probably damaging Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
inauspicious UTSW 18 50146424 missense probably damaging 1.00
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50183261 missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4351:Hsd17b4 UTSW 18 50142634 missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50177209 missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50155185 missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50164850 missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
R7509:Hsd17b4 UTSW 18 50164682 missense probably damaging 1.00
R7697:Hsd17b4 UTSW 18 50130141 missense probably damaging 1.00
R7722:Hsd17b4 UTSW 18 50146524 missense probably damaging 1.00
R7764:Hsd17b4 UTSW 18 50146415 nonsense probably null
R8065:Hsd17b4 UTSW 18 50170752 missense possibly damaging 0.90
Z1177:Hsd17b4 UTSW 18 50181980 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCTGTGACCTGAGAATGGTTC -3'
(R):5'- TGACCCTCCTCCGAGAACTTAC -3'

Sequencing Primer
(F):5'- GACCTGAGAATGGTTCTGATAATG -3'
(R):5'- CTTACTCTACAAATCAAAGCCTGGTG -3'
Posted On2016-12-15