Incidental Mutation 'R5789:Dclre1c'
ID448189
Institutional Source Beutler Lab
Gene Symbol Dclre1c
Ensembl Gene ENSMUSG00000026648
Gene NameDNA cross-link repair 1C
SynonymsArtemis, Art, 9930121L06Rik
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3424131-3464130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3437956 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 51 (Q51L)
Ref Sequence ENSEMBL: ENSMUSP00000110718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066]
Predicted Effect probably benign
Transcript: ENSMUST00000061852
AA Change: Q181L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: Q181L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100463
AA Change: Q181L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648
AA Change: Q181L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102988
AA Change: Q181L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: Q181L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 8.8e-23 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
internal_repeat_1 518 534 4.97e-8 PROSPERO
internal_repeat_1 525 541 4.97e-8 PROSPERO
low complexity region 545 559 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115066
AA Change: Q51L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648
AA Change: Q51L

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129657
SMART Domains Protein: ENSMUSP00000116883
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Pfam:DRMBL 1 96 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146027
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Dclre1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Dclre1c APN 2 3433784 nonsense probably null
IGL02165:Dclre1c APN 2 3450381 splice site probably benign
IGL02955:Dclre1c APN 2 3438052 missense probably damaging 1.00
IGL02961:Dclre1c APN 2 3437033 missense probably damaging 1.00
Chairy UTSW 2 3452863 missense probably damaging 1.00
kiwis UTSW 2 3436475 missense probably damaging 1.00
kleiner UTSW 2 3424236 nonsense probably null
pee-wee UTSW 2 3437705 missense probably damaging 1.00
western_woods UTSW 2 3453169 missense possibly damaging 0.68
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0520:Dclre1c UTSW 2 3436475 missense probably damaging 1.00
R1922:Dclre1c UTSW 2 3440782 missense possibly damaging 0.95
R1994:Dclre1c UTSW 2 3437985 missense probably damaging 1.00
R4418:Dclre1c UTSW 2 3452935 missense possibly damaging 0.82
R4420:Dclre1c UTSW 2 3433745 critical splice acceptor site probably null
R4710:Dclre1c UTSW 2 3440861 critical splice donor site probably null
R6113:Dclre1c UTSW 2 3452863 missense probably damaging 1.00
R6148:Dclre1c UTSW 2 3437705 missense probably damaging 1.00
R6519:Dclre1c UTSW 2 3429329 missense probably damaging 1.00
R6964:Dclre1c UTSW 2 3453169 missense possibly damaging 0.68
R7785:Dclre1c UTSW 2 3424236 nonsense probably null
R8111:Dclre1c UTSW 2 3447148 missense probably benign 0.00
Z1088:Dclre1c UTSW 2 3438080 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGATATGCCTGGGGTGATG -3'
(R):5'- TGTGTCTAGGCAAGCTGCTC -3'

Sequencing Primer
(F):5'- CCTGGGGTGATGAGTCTCC -3'
(R):5'- CACATCCCTGGTTTCGGG -3'
Posted On2016-12-15