Mutagenetix > Incidental Mutations

Incidental Mutation 'R5789:Dclre1c'

448189

Institutional Source

Beutler Lab

Gene Symbol

Dclre1c

Ensembl Gene

ENSMUSG00000026648

Gene Name

DNA cross-link repair 1C

Synonyms

Artemis, Art, 9930121L06Rik

MMRRC Submission

043383-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

R5789 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3424131-3464130 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3437956 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 51 (Q51L)

Ref Sequence

ENSEMBL: ENSMUSP00000110718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066]

Predicted Effect

probably benign
Transcript: ENSMUST00000061852
AA Change: Q181L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: Q181L

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	1.6e-22	PFAM
low complexity region	383	400	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	593	601	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100463
AA Change: Q181L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648
AA Change: Q181L

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	6.5e-23	PFAM
low complexity region	476	484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102988
AA Change: Q181L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: Q181L

Domain	Start	End	E-Value	Type
Lactamase_B	10	193	7.78e0	SMART
Pfam:DRMBL	239	345	8.8e-23	PFAM
low complexity region	383	400	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
internal_repeat_1	518	534	4.97e-8	PROSPERO
internal_repeat_1	525	541	4.97e-8	PROSPERO
low complexity region	545	559	N/A	INTRINSIC
low complexity region	652	662	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115066
AA Change: Q51L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648
AA Change: Q51L

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	25	70	1e-19	BLAST
Pfam:DRMBL	109	215	1.1e-22	PFAM
low complexity region	253	270	N/A	INTRINSIC
low complexity region	333	347	N/A	INTRINSIC
low complexity region	463	471	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129657

SMART Domains

Protein: ENSMUSP00000116883
Gene: ENSMUSG00000026648

Domain	Start	End	E-Value	Type
Pfam:DRMBL	1	96	1.6e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146027

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	A	4: 35,226,112		probably benign	Het
Abcb11	A	G	2: 69,245,764	F1200S	probably damaging	Het
Ahnak	A	T	19: 9,002,321	D323V	probably benign	Het
Aloxe3	T	C	11: 69,126,439	Y13H	probably damaging	Het
Aqp1	A	G	6: 55,336,761	I91V	probably benign	Het
Carmil1	A	G	13: 24,121,848	S318P	probably damaging	Het
Cdan1	A	G	2: 120,729,535	F383L	probably benign	Het
Col6a2	T	A	10: 76,604,389	E606V	probably damaging	Het
Col6a5	T	C	9: 105,864,608	T2371A	possibly damaging	Het
Cops3	T	C	11: 59,830,280		probably benign	Het
Coq7	G	T	7: 118,529,706	H35Q	possibly damaging	Het
Cp	T	A	3: 19,957,290	F3I	probably benign	Het
D630003M21Rik	C	T	2: 158,216,814	E389K	possibly damaging	Het
Dhx37	A	C	5: 125,421,039	I702S	possibly damaging	Het
Dnah3	G	T	7: 119,943,599	A3530D	possibly damaging	Het
Dnajc13	T	C	9: 104,214,188	R635G	probably damaging	Het
Dnhd1	A	G	7: 105,705,010	S3066G	possibly damaging	Het
Doc2b	T	A	11: 75,786,115	H144L	probably damaging	Het
Eif2b3	T	A	4: 117,028,495	I78N	probably damaging	Het
Enpp1	A	T	10: 24,647,239	H767Q	probably benign	Het
Fam180a	C	A	6: 35,313,526	*174L	probably null	Het
Gabra1	A	T	11: 42,182,915		probably benign	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm16551	T	A	9: 74,849,253		noncoding transcript	Het
Ifi213	C	A	1: 173,568,794		probably benign	Het
Inpp4a	T	C	1: 37,372,329	V358A	possibly damaging	Het
Kmt2a	T	C	9: 44,819,904		probably benign	Het
Mrgprb13	A	T	7: 48,312,198		noncoding transcript	Het
Narfl	T	C	17: 25,781,203	C303R	probably benign	Het
Nckap5	A	G	1: 126,027,702	F371S	probably damaging	Het
Nudcd1	G	A	15: 44,388,483	Q428*	probably null	Het
Pcdhgc5	C	A	18: 37,821,506	P611Q	probably damaging	Het
Plekhb1	A	T	7: 100,645,586	Y193*	probably null	Het
Prrt1	T	C	17: 34,631,957		probably null	Het
Ptpn12	G	A	5: 20,989,015	T753I	possibly damaging	Het
Samsn1	T	C	16: 75,876,448	D180G	probably damaging	Het
Sh2d2a	T	A	3: 87,849,513		probably benign	Het
Skiv2l2	A	T	13: 112,891,285	N680K	probably benign	Het
Slc12a2	T	A	18: 57,912,019		probably null	Het
Socs3	T	A	11: 117,967,782	Q150L	probably benign	Het
Supt6	A	G	11: 78,233,586	V23A	unknown	Het
Tcf12	T	C	9: 71,885,236	Y119C	probably damaging	Het
Them5	A	G	3: 94,346,601	E210G	probably damaging	Het
Tmem135	A	G	7: 89,196,122	F167S	possibly damaging	Het
Tmem170	A	G	8: 111,866,400	V134A	possibly damaging	Het
Trbv20	A	G	6: 41,188,791	Y50C	probably damaging	Het
Uroc1	A	G	6: 90,344,197	M252V	probably damaging	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Xpnpep3	T	A	15: 81,415,864		probably benign	Het
Yars	C	T	4: 129,196,897	T78M	probably damaging	Het
Zdhhc16	T	A	19: 41,938,133	H98Q	probably damaging	Het
Zfp90	T	C	8: 106,423,973	L106P	probably benign	Het
Zscan22	T	G	7: 12,903,926	S82A	probably benign	Het

Other mutations in Dclre1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Dclre1c	APN	2	3433784	nonsense	probably null
IGL02165:Dclre1c	APN	2	3450381	splice site	probably benign
IGL02955:Dclre1c	APN	2	3438052	missense	probably damaging	1.00
IGL02961:Dclre1c	APN	2	3437033	missense	probably damaging	1.00
Chairy	UTSW	2	3452863	missense	probably damaging	1.00
kiwis	UTSW	2	3436475	missense	probably damaging	1.00
kleiner	UTSW	2	3424236	nonsense	probably null
pee-wee	UTSW	2	3437705	missense	probably damaging	1.00
western_woods	UTSW	2	3453169	missense	possibly damaging	0.68
R0008:Dclre1c	UTSW	2	3437995	missense	probably damaging	0.99
R0008:Dclre1c	UTSW	2	3437995	missense	probably damaging	0.99
R0520:Dclre1c	UTSW	2	3436475	missense	probably damaging	1.00
R1922:Dclre1c	UTSW	2	3440782	missense	possibly damaging	0.95
R1994:Dclre1c	UTSW	2	3437985	missense	probably damaging	1.00
R4418:Dclre1c	UTSW	2	3452935	missense	possibly damaging	0.82
R4420:Dclre1c	UTSW	2	3433745	critical splice acceptor site	probably null
R4710:Dclre1c	UTSW	2	3440861	critical splice donor site	probably null
R6113:Dclre1c	UTSW	2	3452863	missense	probably damaging	1.00
R6148:Dclre1c	UTSW	2	3437705	missense	probably damaging	1.00
R6519:Dclre1c	UTSW	2	3429329	missense	probably damaging	1.00
R6964:Dclre1c	UTSW	2	3453169	missense	possibly damaging	0.68
R7785:Dclre1c	UTSW	2	3424236	nonsense	probably null
R8111:Dclre1c	UTSW	2	3447148	missense	probably benign	0.00
Z1088:Dclre1c	UTSW	2	3438080	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGATATGCCTGGGGTGATG -3'
(R):5'- TGTGTCTAGGCAAGCTGCTC -3'

Sequencing Primer
(F):5'- CCTGGGGTGATGAGTCTCC -3'
(R):5'- CACATCCCTGGTTTCGGG -3'

Posted On

2016-12-15