Incidental Mutation 'R5789:D630003M21Rik'
ID448192
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 158216814 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 389 (E389K)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046944
AA Change: E389K

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: E389K

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103121
AA Change: E389K

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: E389K

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169335
AA Change: E389K

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: E389K

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTTGGAAGCTCTCCCATGTC -3'
(R):5'- GAAAGACCCTTCCTCTCTCG -3'

Sequencing Primer
(F):5'- GGAAGCTCTCCCATGTCCTAGTG -3'
(R):5'- GGCACCTCCCTTGGGAAGATG -3'
Posted On2016-12-15