Incidental Mutation 'R5789:3110043O21Rik'
ID448196
Institutional Source Beutler Lab
Gene Symbol 3110043O21Rik
Ensembl Gene ENSMUSG00000028300
Gene NameRIKEN cDNA 3110043O21 gene
SynonymsC9orf72
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location35191285-35226175 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 35226112 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084724] [ENSMUST00000108126] [ENSMUST00000108127]
Predicted Effect probably benign
Transcript: ENSMUST00000084724
SMART Domains Protein: ENSMUSP00000081775
Gene: ENSMUSG00000028300

DomainStartEndE-ValueType
Pfam:C9orf72-like 60 325 6.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108126
SMART Domains Protein: ENSMUSP00000103761
Gene: ENSMUSG00000028300

DomainStartEndE-ValueType
Pfam:C9orf72-like 1 161 2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108127
SMART Domains Protein: ENSMUSP00000103762
Gene: ENSMUSG00000028300

DomainStartEndE-ValueType
Pfam:C9orf72-like 61 324 1.9e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156472
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the regulation of endosomal trafficking, and has been shown to interact with Rab proteins that are involved in autophagy and endocytic transport. Expansion of a GGGGCC repeat from 2-22 copies to 700-1600 copies in the intronic sequence between alternate 5' exons in transcripts from this gene is associated with 9p-linked ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia) (PMID: 21944778, 21944779). Studies suggest that hexanucleotide expansions could result in the selective stabilization of repeat-containing pre-mRNA, and the accumulation of insoluble dipeptide repeat protein aggregates that could be pathogenic in FTD-ALS patients (PMID: 23393093). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2016]
PHENOTYPE: Nullizygous mice show splenomegaly and lymphadenopathy. Homozygotes for one allele show reduced body weight, hematocrit and hemoglobin content, lymphopenia, neutrophilia, social interaction deficits and premature death. Homozygotes for another allele show altered macrophage and microglia physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in 3110043O21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:3110043O21Rik APN 4 35213616 missense possibly damaging 0.57
IGL00718:3110043O21Rik APN 4 35213015 missense probably damaging 1.00
IGL01284:3110043O21Rik APN 4 35218808 missense probably damaging 0.96
IGL01998:3110043O21Rik APN 4 35194179 missense probably benign 0.30
IGL02185:3110043O21Rik APN 4 35197046 missense probably damaging 1.00
IGL02403:3110043O21Rik APN 4 35205887 splice site probably benign
IGL02823:3110043O21Rik APN 4 35213031 missense probably damaging 0.98
R0194:3110043O21Rik UTSW 4 35197207 missense probably damaging 1.00
R0471:3110043O21Rik UTSW 4 35193257 missense probably benign 0.01
R1172:3110043O21Rik UTSW 4 35218630 missense probably damaging 0.99
R1175:3110043O21Rik UTSW 4 35218630 missense probably damaging 0.99
R1765:3110043O21Rik UTSW 4 35197098 missense probably damaging 1.00
R4326:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4327:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4328:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4679:3110043O21Rik UTSW 4 35226033 unclassified probably benign
R4844:3110043O21Rik UTSW 4 35213565 missense possibly damaging 0.47
R5150:3110043O21Rik UTSW 4 35193270 missense possibly damaging 0.92
R5528:3110043O21Rik UTSW 4 35213556 missense probably benign 0.18
R7790:3110043O21Rik UTSW 4 35192997 missense unknown
R7805:3110043O21Rik UTSW 4 35194170 missense
R8115:3110043O21Rik UTSW 4 35218763 missense
Predicted Primers PCR Primer
(F):5'- AGGAGTTCACCTCGAAGGAG -3'
(R):5'- TCTTGGAAGAAAAGCTACAAAGCCC -3'

Sequencing Primer
(F):5'- CAGACCCAGAATCTGCAGGG -3'
(R):5'- CATGACAGCCTCCGCCTG -3'
Posted On2016-12-15