Mutagenetix > Incidental Mutations

Incidental Mutation 'R5789:Eif2b3'

448197

Institutional Source

Beutler Lab

Gene Symbol

Eif2b3

Ensembl Gene

ENSMUSG00000028683

Gene Name

eukaryotic translation initiation factor 2B, subunit 3

Synonyms

1190002P15Rik

MMRRC Submission

043383-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5789 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117019402-117087306 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 117028495 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 78 (I78N)

Ref Sequence

ENSEMBL: ENSMUSP00000102056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070610
AA Change: I78N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: I78N

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	139	8.2e-20	PFAM
Pfam:NTP_transf_3	5	226	8.5e-19	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106447
AA Change: I78N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: I78N

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	139	1.1e-19	PFAM
Pfam:NTP_transf_3	5	221	1.7e-18	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106448
AA Change: I78N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: I78N

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	140	3.2e-19	PFAM
Pfam:NTP_transf_3	5	237	3.7e-18	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157724

Meta Mutation Damage Score

0.7868

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	A	4: 35,226,112		probably benign	Het
Abcb11	A	G	2: 69,245,764	F1200S	probably damaging	Het
Ahnak	A	T	19: 9,002,321	D323V	probably benign	Het
Aloxe3	T	C	11: 69,126,439	Y13H	probably damaging	Het
Aqp1	A	G	6: 55,336,761	I91V	probably benign	Het
Carmil1	A	G	13: 24,121,848	S318P	probably damaging	Het
Cdan1	A	G	2: 120,729,535	F383L	probably benign	Het
Col6a2	T	A	10: 76,604,389	E606V	probably damaging	Het
Col6a5	T	C	9: 105,864,608	T2371A	possibly damaging	Het
Cops3	T	C	11: 59,830,280		probably benign	Het
Coq7	G	T	7: 118,529,706	H35Q	possibly damaging	Het
Cp	T	A	3: 19,957,290	F3I	probably benign	Het
D630003M21Rik	C	T	2: 158,216,814	E389K	possibly damaging	Het
Dclre1c	A	T	2: 3,437,956	Q51L	probably damaging	Het
Dhx37	A	C	5: 125,421,039	I702S	possibly damaging	Het
Dnah3	G	T	7: 119,943,599	A3530D	possibly damaging	Het
Dnajc13	T	C	9: 104,214,188	R635G	probably damaging	Het
Dnhd1	A	G	7: 105,705,010	S3066G	possibly damaging	Het
Doc2b	T	A	11: 75,786,115	H144L	probably damaging	Het
Enpp1	A	T	10: 24,647,239	H767Q	probably benign	Het
Fam180a	C	A	6: 35,313,526	*174L	probably null	Het
Gabra1	A	T	11: 42,182,915		probably benign	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm16551	T	A	9: 74,849,253		noncoding transcript	Het
Ifi213	C	A	1: 173,568,794		probably benign	Het
Inpp4a	T	C	1: 37,372,329	V358A	possibly damaging	Het
Kmt2a	T	C	9: 44,819,904		probably benign	Het
Mrgprb13	A	T	7: 48,312,198		noncoding transcript	Het
Narfl	T	C	17: 25,781,203	C303R	probably benign	Het
Nckap5	A	G	1: 126,027,702	F371S	probably damaging	Het
Nudcd1	G	A	15: 44,388,483	Q428*	probably null	Het
Pcdhgc5	C	A	18: 37,821,506	P611Q	probably damaging	Het
Plekhb1	A	T	7: 100,645,586	Y193*	probably null	Het
Prrt1	T	C	17: 34,631,957		probably null	Het
Ptpn12	G	A	5: 20,989,015	T753I	possibly damaging	Het
Samsn1	T	C	16: 75,876,448	D180G	probably damaging	Het
Sh2d2a	T	A	3: 87,849,513		probably benign	Het
Skiv2l2	A	T	13: 112,891,285	N680K	probably benign	Het
Slc12a2	T	A	18: 57,912,019		probably null	Het
Socs3	T	A	11: 117,967,782	Q150L	probably benign	Het
Supt6	A	G	11: 78,233,586	V23A	unknown	Het
Tcf12	T	C	9: 71,885,236	Y119C	probably damaging	Het
Them5	A	G	3: 94,346,601	E210G	probably damaging	Het
Tmem135	A	G	7: 89,196,122	F167S	possibly damaging	Het
Tmem170	A	G	8: 111,866,400	V134A	possibly damaging	Het
Trbv20	A	G	6: 41,188,791	Y50C	probably damaging	Het
Uroc1	A	G	6: 90,344,197	M252V	probably damaging	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Xpnpep3	T	A	15: 81,415,864		probably benign	Het
Yars	C	T	4: 129,196,897	T78M	probably damaging	Het
Zdhhc16	T	A	19: 41,938,133	H98Q	probably damaging	Het
Zfp90	T	C	8: 106,423,973	L106P	probably benign	Het
Zscan22	T	G	7: 12,903,926	S82A	probably benign	Het

Other mutations in Eif2b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Eif2b3	APN	4	117066469	missense	probably benign
IGL01333:Eif2b3	APN	4	117070690	missense	probably benign	0.31
IGL01564:Eif2b3	APN	4	117028542	missense	probably benign	0.00
IGL01721:Eif2b3	APN	4	117058804	missense	probably damaging	1.00
IGL02061:Eif2b3	APN	4	117028411	missense	possibly damaging	0.78
R0835:Eif2b3	UTSW	4	117058805	missense	probably damaging	1.00
R0924:Eif2b3	UTSW	4	117081578	missense	possibly damaging	0.93
R2167:Eif2b3	UTSW	4	117028540	missense	probably damaging	1.00
R2424:Eif2b3	UTSW	4	117070848	missense	probably benign	0.01
R3902:Eif2b3	UTSW	4	117022207	missense	probably damaging	1.00
R4105:Eif2b3	UTSW	4	117081634	missense	probably damaging	1.00
R4688:Eif2b3	UTSW	4	117058849	missense	probably benign	0.03
R4998:Eif2b3	UTSW	4	117066392	missense	probably benign	0.06
R5033:Eif2b3	UTSW	4	117052736	missense	probably damaging	1.00
R5123:Eif2b3	UTSW	4	117022211	missense	probably damaging	1.00
R5493:Eif2b3	UTSW	4	117086722	missense	possibly damaging	0.92
R5787:Eif2b3	UTSW	4	117044440	missense	probably damaging	1.00
R6347:Eif2b3	UTSW	4	117044566	missense	probably benign	0.05
R6361:Eif2b3	UTSW	4	117028425	missense	possibly damaging	0.66
R6643:Eif2b3	UTSW	4	117070757	missense	probably damaging	0.97
R6798:Eif2b3	UTSW	4	117066458	missense	probably benign	0.00
R7299:Eif2b3	UTSW	4	117052822	missense	probably benign	0.27
R7301:Eif2b3	UTSW	4	117052822	missense	probably benign	0.27
R7451:Eif2b3	UTSW	4	117052796	nonsense	probably null
R7934:Eif2b3	UTSW	4	117066478	missense	probably benign
R8117:Eif2b3	UTSW	4	117022217	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGCTCAGTCATATTAGCATTTATCAT -3'
(R):5'- AAGTGGGAAACAATGAACTTGATATA -3'

Sequencing Primer
(F):5'- GATTCTATACGCTGGCTTTGAAC -3'
(R):5'- TGGCAAATTCTAGGCTAGCC -3'

Posted On

2016-12-15