Incidental Mutation 'R5789:Dhx37'
ID448201
Institutional Source Beutler Lab
Gene Symbol Dhx37
Ensembl Gene ENSMUSG00000029480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 37
SynonymsLOC381671, LOC208144
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125413858-125434121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 125421039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 702 (I702S)
Ref Sequence ENSEMBL: ENSMUSP00000131734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169485
AA Change: I702S

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131734
Gene: ENSMUSG00000029480
AA Change: I702S

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
DEXDc 246 438 3.55e-27 SMART
AAA 263 463 9.3e-3 SMART
HELICc 554 669 1.56e-14 SMART
Blast:DEXDc 678 717 1e-10 BLAST
HA2 729 852 3.32e-25 SMART
Pfam:OB_NTP_bind 886 1004 1.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196444
Predicted Effect probably benign
Transcript: ENSMUST00000198746
Meta Mutation Damage Score 0.7878 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Dhx37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Dhx37 APN 5 125419088 missense possibly damaging 0.84
IGL02010:Dhx37 APN 5 125418713 missense possibly damaging 0.58
IGL02412:Dhx37 APN 5 125431628 missense probably damaging 0.98
IGL02484:Dhx37 APN 5 125419337 missense possibly damaging 0.89
IGL02986:Dhx37 APN 5 125419315 missense probably damaging 1.00
FR4304:Dhx37 UTSW 5 125427530 unclassified probably benign
R0010:Dhx37 UTSW 5 125431616 missense probably benign 0.02
R0019:Dhx37 UTSW 5 125430034 missense probably benign 0.36
R0485:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R0959:Dhx37 UTSW 5 125423432 missense probably benign
R1101:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R1132:Dhx37 UTSW 5 125421039 missense probably damaging 0.96
R1309:Dhx37 UTSW 5 125417438 nonsense probably null
R1777:Dhx37 UTSW 5 125429931 missense probably benign
R2001:Dhx37 UTSW 5 125427464 missense probably damaging 1.00
R2116:Dhx37 UTSW 5 125421102 missense probably damaging 0.98
R3826:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3829:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3830:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R4007:Dhx37 UTSW 5 125424931 splice site probably benign
R5058:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R5158:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R5436:Dhx37 UTSW 5 125429803 missense probably benign
R5834:Dhx37 UTSW 5 125425730 missense probably damaging 1.00
R6066:Dhx37 UTSW 5 125424666 missense probably benign 0.18
R6490:Dhx37 UTSW 5 125419132 missense probably benign 0.00
R6967:Dhx37 UTSW 5 125422167 missense probably benign 0.07
R7101:Dhx37 UTSW 5 125424942 nonsense probably null
R8036:Dhx37 UTSW 5 125424675 missense probably benign
Z1088:Dhx37 UTSW 5 125416591 missense possibly damaging 0.72
Z1177:Dhx37 UTSW 5 125424980 missense possibly damaging 0.81
Z1177:Dhx37 UTSW 5 125425472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATTAGGGACTGAAGGCCAC -3'
(R):5'- TACAGAGTATATAGTCAGGGTAGCTG -3'

Sequencing Primer
(F):5'- ACCAGGACACCTTCTGATTGG -3'
(R):5'- ACTAACTGCCCTGGTGAGG -3'
Posted On2016-12-15