Incidental Mutation 'R5789:Zscan22'
ID448206
Institutional Source Beutler Lab
Gene Symbol Zscan22
Ensembl Gene ENSMUSG00000054715
Gene Namezinc finger and SCAN domain containing 22
SynonymsD530006B18Rik, Hkr2
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12897815-12909083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12903926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 82 (S82A)
Ref Sequence ENSEMBL: ENSMUSP00000113314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055528] [ENSMUST00000117189] [ENSMUST00000119989] [ENSMUST00000120809]
Predicted Effect probably benign
Transcript: ENSMUST00000055528
AA Change: S82A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057651
Gene: ENSMUSG00000054715
AA Change: S82A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
SCAN 45 154 8.03e-50 SMART
ZnF_C2H2 273 292 6.64e1 SMART
ZnF_C2H2 298 320 6.88e-4 SMART
ZnF_C2H2 326 348 1.04e-3 SMART
ZnF_C2H2 354 376 8.02e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.06e-4 SMART
ZnF_C2H2 438 460 3.21e-4 SMART
ZnF_C2H2 466 488 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117189
SMART Domains Protein: ENSMUSP00000112684
Gene: ENSMUSG00000054715

DomainStartEndE-ValueType
ZnF_C2H2 114 133 6.64e1 SMART
ZnF_C2H2 139 161 6.88e-4 SMART
ZnF_C2H2 167 189 1.04e-3 SMART
ZnF_C2H2 195 217 8.02e-5 SMART
ZnF_C2H2 223 245 6.42e-4 SMART
ZnF_C2H2 251 273 1.06e-4 SMART
ZnF_C2H2 279 301 3.21e-4 SMART
ZnF_C2H2 307 329 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119989
SMART Domains Protein: ENSMUSP00000113486
Gene: ENSMUSG00000054715

DomainStartEndE-ValueType
ZnF_C2H2 114 133 6.64e1 SMART
ZnF_C2H2 139 161 6.88e-4 SMART
ZnF_C2H2 167 189 1.04e-3 SMART
ZnF_C2H2 195 217 8.02e-5 SMART
ZnF_C2H2 223 245 6.42e-4 SMART
ZnF_C2H2 251 273 1.06e-4 SMART
ZnF_C2H2 279 301 3.21e-4 SMART
ZnF_C2H2 307 329 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120809
AA Change: S82A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113314
Gene: ENSMUSG00000054715
AA Change: S82A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
SCAN 45 154 8.03e-50 SMART
ZnF_C2H2 273 292 6.64e1 SMART
ZnF_C2H2 298 320 6.88e-4 SMART
ZnF_C2H2 326 348 1.04e-3 SMART
ZnF_C2H2 354 376 8.02e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.06e-4 SMART
ZnF_C2H2 438 460 3.21e-4 SMART
ZnF_C2H2 466 488 1.72e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Other mutations in Zscan22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Zscan22 APN 7 12906471 missense probably benign 0.01
IGL02408:Zscan22 APN 7 12906499 missense probably benign 0.09
PIT4378001:Zscan22 UTSW 7 12904056 missense possibly damaging 0.89
R0079:Zscan22 UTSW 7 12904087 critical splice donor site probably null
R1677:Zscan22 UTSW 7 12906803 missense probably damaging 1.00
R1731:Zscan22 UTSW 7 12906980 missense probably damaging 1.00
R1944:Zscan22 UTSW 7 12903840 missense probably damaging 0.98
R2258:Zscan22 UTSW 7 12903960 missense probably damaging 1.00
R2276:Zscan22 UTSW 7 12906823 nonsense probably null
R3115:Zscan22 UTSW 7 12907290 missense probably benign 0.39
R4064:Zscan22 UTSW 7 12907014 missense probably damaging 1.00
R4274:Zscan22 UTSW 7 12906324 missense probably benign 0.01
R4691:Zscan22 UTSW 7 12906561 missense probably benign 0.06
R5355:Zscan22 UTSW 7 12906508 missense probably benign 0.00
R5607:Zscan22 UTSW 7 12906992 missense probably damaging 1.00
R5608:Zscan22 UTSW 7 12906992 missense probably damaging 1.00
R6293:Zscan22 UTSW 7 12906907 nonsense probably null
R7210:Zscan22 UTSW 7 12906821 missense probably damaging 0.98
R7475:Zscan22 UTSW 7 12906737 missense probably damaging 0.99
R7491:Zscan22 UTSW 7 12906906 missense probably damaging 1.00
R8321:Zscan22 UTSW 7 12903698 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGGAAGAAGCTAGCGACTCC -3'
(R):5'- GCAATCCTGAACTAGAGCTTGC -3'

Sequencing Primer
(F):5'- AAGCTAGCGACTCCCCGAG -3'
(R):5'- GAACTAGAGCTTGCCATTGTAGCC -3'
Posted On2016-12-15