Incidental Mutation 'R5789:Tmem135'
ID448208
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Nametransmembrane protein 135
Synonyms
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89139714-89404222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89196122 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 167 (F167S)
Ref Sequence ENSEMBL: ENSMUSP00000042783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000117852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041968
AA Change: F167S

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428
AA Change: F167S

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117852
AA Change: F167S

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428
AA Change: F167S

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139320
Meta Mutation Damage Score 0.1503 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 89151438 missense probably damaging 1.00
IGL01730:Tmem135 APN 7 89148044 missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 89143857 unclassified probably benign
IGL02177:Tmem135 APN 7 89338453 missense probably damaging 1.00
IGL02305:Tmem135 APN 7 89165123 critical splice donor site probably null
IGL02747:Tmem135 APN 7 89144670 missense probably damaging 0.98
IGL02801:Tmem135 APN 7 89154125 missense probably benign 0.13
IGL03353:Tmem135 APN 7 89141953 missense probably damaging 1.00
skim UTSW 7 89196127 nonsense probably null
R0631:Tmem135 UTSW 7 89143788 nonsense probably null
R0657:Tmem135 UTSW 7 89144682 missense probably damaging 0.96
R2233:Tmem135 UTSW 7 89154074 missense probably damaging 1.00
R3118:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R3119:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R5094:Tmem135 UTSW 7 89143793 missense probably damaging 1.00
R5225:Tmem135 UTSW 7 89196127 nonsense probably null
R5248:Tmem135 UTSW 7 89147992 missense probably damaging 1.00
R5356:Tmem135 UTSW 7 89305515 missense probably benign 0.06
R5372:Tmem135 UTSW 7 89165174 splice site probably null
R5442:Tmem135 UTSW 7 89144664 missense probably damaging 1.00
R5863:Tmem135 UTSW 7 89147968 critical splice donor site probably null
R6158:Tmem135 UTSW 7 89156444 missense probably benign 0.12
R6383:Tmem135 UTSW 7 89144670 missense probably damaging 0.98
R6416:Tmem135 UTSW 7 89147794 missense probably benign
R6659:Tmem135 UTSW 7 89307163 missense probably benign 0.07
R6659:Tmem135 UTSW 7 89307164 nonsense probably null
R6731:Tmem135 UTSW 7 89243964 missense possibly damaging 0.96
R7545:Tmem135 UTSW 7 89305519 missense probably damaging 1.00
R7626:Tmem135 UTSW 7 89156510 splice site probably null
R8089:Tmem135 UTSW 7 89156495 missense probably damaging 0.99
R8447:Tmem135 UTSW 7 89154032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGTCATAGGAAAGTGACAGAC -3'
(R):5'- TAATGAGAGCTTCTGTGTCATTGC -3'

Sequencing Primer
(F):5'- GTGACAGACACCTTTTGTATTCTTAC -3'
(R):5'- ATTGCATTGCACGAAGCCTG -3'
Posted On2016-12-15