Incidental Mutation 'R5789:Plekhb1'
ID448209
Institutional Source Beutler Lab
Gene Symbol Plekhb1
Ensembl Gene ENSMUSG00000030701
Gene Namepleckstrin homology domain containing, family B (evectins) member 1
SynonymsPHR1, Phret1, evt-1
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100642892-100662414 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 100645586 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 193 (Y193*)
Ref Sequence ENSEMBL: ENSMUSP00000115559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032946] [ENSMUST00000079176] [ENSMUST00000098252] [ENSMUST00000107043] [ENSMUST00000107044] [ENSMUST00000107045] [ENSMUST00000107046] [ENSMUST00000107047] [ENSMUST00000107048] [ENSMUST00000116287] [ENSMUST00000138830] [ENSMUST00000139708] [ENSMUST00000151123]
Predicted Effect probably benign
Transcript: ENSMUST00000032946
SMART Domains Protein: ENSMUSP00000032946
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 6.24e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079176
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000078175
Gene: ENSMUSG00000030701
AA Change: Y193*

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098252
SMART Domains Protein: ENSMUSP00000095852
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 5.52e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107043
AA Change: M126K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102658
Gene: ENSMUSG00000030701
AA Change: M126K

DomainStartEndE-ValueType
PDB:2D9V|A 2 103 1e-68 PDB
SCOP:d1dbha2 3 97 7e-12 SMART
Blast:PH 3 103 9e-67 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107044
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000102659
Gene: ENSMUSG00000030701
AA Change: Y139*

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107045
AA Change: Y174*
SMART Domains Protein: ENSMUSP00000102660
Gene: ENSMUSG00000030701
AA Change: Y174*

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107046
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000102661
Gene: ENSMUSG00000030701
AA Change: Y139*

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107047
AA Change: Y158*
SMART Domains Protein: ENSMUSP00000102662
Gene: ENSMUSG00000030701
AA Change: Y158*

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107048
SMART Domains Protein: ENSMUSP00000102663
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 1 144 2.57e-67 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116287
AA Change: Y174*
SMART Domains Protein: ENSMUSP00000111991
Gene: ENSMUSG00000030701
AA Change: Y174*

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135255
Predicted Effect probably benign
Transcript: ENSMUST00000138830
SMART Domains Protein: ENSMUSP00000116888
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139708
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000122333
Gene: ENSMUSG00000030701
AA Change: Y139*

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151123
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000115559
Gene: ENSMUSG00000030701
AA Change: Y193*

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable with no abnormalities detected in growth, behavior including balance, inner ear histology, or serum and urine electrolyte concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Plekhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Plekhb1 APN 7 100655299 missense probably damaging 1.00
F5770:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
R0722:Plekhb1 UTSW 7 100645603 missense probably damaging 1.00
R1891:Plekhb1 UTSW 7 100655392 missense probably damaging 1.00
R3427:Plekhb1 UTSW 7 100645650 missense probably damaging 1.00
R5506:Plekhb1 UTSW 7 100644943 splice site probably null
R5695:Plekhb1 UTSW 7 100655395 missense probably damaging 1.00
R5696:Plekhb1 UTSW 7 100656753 missense probably damaging 1.00
R6633:Plekhb1 UTSW 7 100645639 missense probably damaging 1.00
R7304:Plekhb1 UTSW 7 100645667 missense probably benign 0.19
R7763:Plekhb1 UTSW 7 100645663 missense probably benign
R8271:Plekhb1 UTSW 7 100656729 splice site probably benign
V7580:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7582:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7583:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATCACTGTTTGGTAGACTGGC -3'
(R):5'- AATCTATGGGGAGGCCATACC -3'

Sequencing Primer
(F):5'- AGACTGGCTGAGTGGGGC -3'
(R):5'- TTCCCTTTAGCCCTGGGGAG -3'
Posted On2016-12-15