Mutagenetix > Incidental Mutations

Incidental Mutation 'R5789:Dnhd1'

448210

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

043383-MU

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R5789 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105705010 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 3066 (S3066G)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000145988]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145988
AA Change: S3066G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: S3066G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Meta Mutation Damage Score

0.1864

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

97% (61/63)

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	A	4: 35,226,112		probably benign	Het
Abcb11	A	G	2: 69,245,764	F1200S	probably damaging	Het
Ahnak	A	T	19: 9,002,321	D323V	probably benign	Het
Aloxe3	T	C	11: 69,126,439	Y13H	probably damaging	Het
Aqp1	A	G	6: 55,336,761	I91V	probably benign	Het
Carmil1	A	G	13: 24,121,848	S318P	probably damaging	Het
Cdan1	A	G	2: 120,729,535	F383L	probably benign	Het
Col6a2	T	A	10: 76,604,389	E606V	probably damaging	Het
Col6a5	T	C	9: 105,864,608	T2371A	possibly damaging	Het
Cops3	T	C	11: 59,830,280		probably benign	Het
Coq7	G	T	7: 118,529,706	H35Q	possibly damaging	Het
Cp	T	A	3: 19,957,290	F3I	probably benign	Het
D630003M21Rik	C	T	2: 158,216,814	E389K	possibly damaging	Het
Dclre1c	A	T	2: 3,437,956	Q51L	probably damaging	Het
Dhx37	A	C	5: 125,421,039	I702S	possibly damaging	Het
Dnah3	G	T	7: 119,943,599	A3530D	possibly damaging	Het
Dnajc13	T	C	9: 104,214,188	R635G	probably damaging	Het
Doc2b	T	A	11: 75,786,115	H144L	probably damaging	Het
Eif2b3	T	A	4: 117,028,495	I78N	probably damaging	Het
Enpp1	A	T	10: 24,647,239	H767Q	probably benign	Het
Fam180a	C	A	6: 35,313,526	*174L	probably null	Het
Gabra1	A	T	11: 42,182,915		probably benign	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm16551	T	A	9: 74,849,253		noncoding transcript	Het
Ifi213	C	A	1: 173,568,794		probably benign	Het
Inpp4a	T	C	1: 37,372,329	V358A	possibly damaging	Het
Kmt2a	T	C	9: 44,819,904		probably benign	Het
Mrgprb13	A	T	7: 48,312,198		noncoding transcript	Het
Narfl	T	C	17: 25,781,203	C303R	probably benign	Het
Nckap5	A	G	1: 126,027,702	F371S	probably damaging	Het
Nudcd1	G	A	15: 44,388,483	Q428*	probably null	Het
Pcdhgc5	C	A	18: 37,821,506	P611Q	probably damaging	Het
Plekhb1	A	T	7: 100,645,586	Y193*	probably null	Het
Prrt1	T	C	17: 34,631,957		probably null	Het
Ptpn12	G	A	5: 20,989,015	T753I	possibly damaging	Het
Samsn1	T	C	16: 75,876,448	D180G	probably damaging	Het
Sh2d2a	T	A	3: 87,849,513		probably benign	Het
Skiv2l2	A	T	13: 112,891,285	N680K	probably benign	Het
Slc12a2	T	A	18: 57,912,019		probably null	Het
Socs3	T	A	11: 117,967,782	Q150L	probably benign	Het
Supt6	A	G	11: 78,233,586	V23A	unknown	Het
Tcf12	T	C	9: 71,885,236	Y119C	probably damaging	Het
Them5	A	G	3: 94,346,601	E210G	probably damaging	Het
Tmem135	A	G	7: 89,196,122	F167S	possibly damaging	Het
Tmem170	A	G	8: 111,866,400	V134A	possibly damaging	Het
Trbv20	A	G	6: 41,188,791	Y50C	probably damaging	Het
Uroc1	A	G	6: 90,344,197	M252V	probably damaging	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Xpnpep3	T	A	15: 81,415,864		probably benign	Het
Yars	C	T	4: 129,196,897	T78M	probably damaging	Het
Zdhhc16	T	A	19: 41,938,133	H98Q	probably damaging	Het
Zfp90	T	C	8: 106,423,973	L106P	probably benign	Het
Zscan22	T	G	7: 12,903,926	S82A	probably benign	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1503:Dnhd1	UTSW	7	105693660	missense	possibly damaging	0.67
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5288:Dnhd1	UTSW	7	105714437	missense	possibly damaging	0.94
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6860:Dnhd1	UTSW	7	105678266	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7326:Dnhd1	UTSW	7	105720930	missense	probably damaging	0.96
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7922:Dnhd1	UTSW	7	105668514	missense	probably damaging	1.00
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACAGCTGTGTCCTCTCTGAC -3'
(R):5'- AGGAAAAGATCTGCTCTCAGTTC -3'

Sequencing Primer
(F):5'- GACTTCCAGGTTTTACCAGCAAGTG -3'
(R):5'- AGATCTGCTCTCAGTTCAGGAAG -3'

Posted On

2016-12-15