Incidental Mutation 'R5789:Coq7'
ID448211
Institutional Source Beutler Lab
Gene Symbol Coq7
Ensembl Gene ENSMUSG00000030652
Gene Namedemethyl-Q 7
Synonymsclk-1
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118509659-118533356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118529706 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 35 (H35Q)
Ref Sequence ENSEMBL: ENSMUSP00000095695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032887] [ENSMUST00000098090] [ENSMUST00000209146]
Predicted Effect probably benign
Transcript: ENSMUST00000032887
AA Change: H35Q

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032887
Gene: ENSMUSG00000030652
AA Change: H35Q

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 217 3.5e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098090
AA Change: H35Q

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652
AA Change: H35Q

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207046
Predicted Effect probably benign
Transcript: ENSMUST00000209146
AA Change: H35Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for null mutations in this gene are embryonic lethal during mid-gestation with aborted neurogenesis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Coq7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Coq7 APN 7 118525304 missense probably damaging 0.98
R0309:Coq7 UTSW 7 118529717 missense possibly damaging 0.92
R0628:Coq7 UTSW 7 118529644 missense probably damaging 1.00
R1459:Coq7 UTSW 7 118510037 missense unknown
R1535:Coq7 UTSW 7 118529674 missense possibly damaging 0.48
R1612:Coq7 UTSW 7 118509911 missense unknown
R2519:Coq7 UTSW 7 118510148 missense unknown
R4095:Coq7 UTSW 7 118527478 critical splice acceptor site probably null
R4516:Coq7 UTSW 7 118509907 missense unknown
R4972:Coq7 UTSW 7 118510117 missense unknown
R5183:Coq7 UTSW 7 118528267 intron probably benign
R5579:Coq7 UTSW 7 118517335 missense unknown
R5619:Coq7 UTSW 7 118527486 splice site probably benign
R6530:Coq7 UTSW 7 118525335 missense probably benign 0.01
R6911:Coq7 UTSW 7 118510162 missense unknown
R7212:Coq7 UTSW 7 118510048 missense unknown
R7248:Coq7 UTSW 7 118529674 missense probably benign 0.42
R7361:Coq7 UTSW 7 118529575 missense probably benign 0.15
R7781:Coq7 UTSW 7 118525888 missense probably damaging 1.00
R8039:Coq7 UTSW 7 118533246 missense possibly damaging 0.93
RF001:Coq7 UTSW 7 118533182 missense probably benign 0.05
Z1177:Coq7 UTSW 7 118510149 missense unknown
Predicted Primers PCR Primer
(F):5'- AACAGACTGGGCTGAGACTC -3'
(R):5'- ACACTGGTAGATGTGTCCAGCC -3'

Sequencing Primer
(F):5'- GCTGAGACTCAGGGAAGAACC -3'
(R):5'- TCATTCTGTCGGCAAAAAGGC -3'
Posted On2016-12-15