Incidental Mutation 'R5789:Zfp90'
ID448213
Institutional Source Beutler Lab
Gene Symbol Zfp90
Ensembl Gene ENSMUSG00000031907
Gene Namezinc finger protein 90
SynonymsKRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106415327-106426598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106423973 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 106 (L106P)
Ref Sequence ENSEMBL: ENSMUSP00000148744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]
Predicted Effect probably benign
Transcript: ENSMUST00000034382
AA Change: L106P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: L106P

DomainStartEndE-ValueType
KRAB 14 74 4.83e-40 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 250 272 2.75e-3 SMART
ZnF_C2H2 278 300 3.83e-2 SMART
ZnF_C2H2 306 328 1.13e-4 SMART
ZnF_C2H2 334 356 2.09e-3 SMART
ZnF_C2H2 362 384 3.16e-3 SMART
ZnF_C2H2 390 412 1.6e-4 SMART
ZnF_C2H2 446 468 1.92e-2 SMART
ZnF_C2H2 494 516 3.69e-4 SMART
ZnF_C2H2 522 544 5.59e-4 SMART
ZnF_C2H2 550 572 1.28e-3 SMART
ZnF_C2H2 578 600 1.28e-3 SMART
ZnF_C2H2 606 628 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211958
Predicted Effect probably benign
Transcript: ENSMUST00000212606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212866
Predicted Effect probably benign
Transcript: ENSMUST00000212874
AA Change: L106P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213045
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Zfp90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Zfp90 APN 8 106424150 missense probably benign 0.00
IGL02170:Zfp90 APN 8 106419524 missense probably damaging 0.99
IGL02818:Zfp90 APN 8 106424209 missense probably benign
R0378:Zfp90 UTSW 8 106425506 missense possibly damaging 0.69
R0462:Zfp90 UTSW 8 106425260 missense possibly damaging 0.89
R1555:Zfp90 UTSW 8 106424095 missense probably benign
R1869:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R1870:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R2110:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R2112:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R3717:Zfp90 UTSW 8 106424050 missense probably benign 0.12
R4506:Zfp90 UTSW 8 106424864 missense possibly damaging 0.78
R5288:Zfp90 UTSW 8 106425368 missense probably damaging 1.00
R5691:Zfp90 UTSW 8 106425078 nonsense probably null
R6283:Zfp90 UTSW 8 106425394 missense probably damaging 1.00
R6560:Zfp90 UTSW 8 106415747 missense probably damaging 0.99
R6977:Zfp90 UTSW 8 106425316 missense probably damaging 1.00
R6977:Zfp90 UTSW 8 106425317 missense probably damaging 0.99
R7040:Zfp90 UTSW 8 106425009 nonsense probably null
R7196:Zfp90 UTSW 8 106425148 missense probably damaging 0.99
R7523:Zfp90 UTSW 8 106423913 missense probably benign 0.07
R7535:Zfp90 UTSW 8 106424268 missense possibly damaging 0.94
R7546:Zfp90 UTSW 8 106424691 missense probably benign 0.22
R7719:Zfp90 UTSW 8 106419093 missense probably damaging 1.00
R8036:Zfp90 UTSW 8 106419128 missense probably benign 0.21
R8056:Zfp90 UTSW 8 106424480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGCATCTTTCTCTAAGG -3'
(R):5'- ACTTGAAGAAATGTCCAGTTGTGG -3'

Sequencing Primer
(F):5'- CAGGCATCTTTCTCTAAGGGACTG -3'
(R):5'- TGGAACCAAGTCTGTGCTC -3'
Posted On2016-12-15