Incidental Mutation 'R5789:Gfral'
ID448218
Institutional Source Beutler Lab
Gene Symbol Gfral
Ensembl Gene ENSMUSG00000059383
Gene NameGDNF family receptor alpha like
SynonymsGRAL
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76164102-76213657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76197046 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 228 (R228Q)
Ref Sequence ENSEMBL: ENSMUSP00000139120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074880] [ENSMUST00000184693]
Predicted Effect probably benign
Transcript: ENSMUST00000074880
AA Change: R228Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074421
Gene: ENSMUSG00000059383
AA Change: R228Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
GDNF 220 316 3.15e-17 SMART
transmembrane domain 351 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184693
AA Change: R228Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139120
Gene: ENSMUSG00000059383
AA Change: R228Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased susceptibility to diet-induced obesity caused by overeating and reduced glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Gfral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Gfral APN 9 76164825 nonsense probably null
IGL02383:Gfral APN 9 76197092 missense probably damaging 0.97
IGL02987:Gfral APN 9 76197301 missense possibly damaging 0.82
IGL03002:Gfral APN 9 76197238 missense possibly damaging 0.61
IGL03055:Gfral UTSW 9 76208549 missense probably benign 0.00
PIT4585001:Gfral UTSW 9 76197294 missense probably damaging 1.00
R0268:Gfral UTSW 9 76197101 missense probably damaging 1.00
R0547:Gfral UTSW 9 76208642 missense probably benign 0.16
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1275:Gfral UTSW 9 76197032 missense probably damaging 1.00
R1830:Gfral UTSW 9 76193203 missense probably benign 0.01
R2249:Gfral UTSW 9 76193349 missense probably damaging 1.00
R3709:Gfral UTSW 9 76193443 nonsense probably null
R4712:Gfral UTSW 9 76193445 missense possibly damaging 0.71
R5567:Gfral UTSW 9 76208618 missense probably benign 0.00
R5568:Gfral UTSW 9 76164805 makesense probably null
R5719:Gfral UTSW 9 76197046 missense probably benign 0.02
R5791:Gfral UTSW 9 76197046 missense probably benign 0.02
R7110:Gfral UTSW 9 76164830 missense possibly damaging 0.84
R7549:Gfral UTSW 9 76198975 missense probably benign 0.14
R7782:Gfral UTSW 9 76193290 missense probably benign 0.43
R7851:Gfral UTSW 9 76205455 missense probably benign 0.03
Z1177:Gfral UTSW 9 76205389 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGTGCCACAACACATGTACC -3'
(R):5'- GCAAATGGAAATCTGTGTGATGTG -3'

Sequencing Primer
(F):5'- CACATGTACCACAGATTCAAAATGTG -3'
(R):5'- ATCTGTGTGATGTGAAACACTGCC -3'
Posted On2016-12-15