Incidental Mutation 'R5789:Gabra1'
ID448223
Institutional Source Beutler Lab
Gene Symbol Gabra1
Ensembl Gene ENSMUSG00000010803
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
SynonymsGabra-1, GABAAR alpha1, GABAA alpha 1
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location42130939-42182930 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 42182915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020707] [ENSMUST00000132971] [ENSMUST00000153147] [ENSMUST00000205546] [ENSMUST00000206085] [ENSMUST00000206105] [ENSMUST00000207274]
Predicted Effect probably benign
Transcript: ENSMUST00000020707
SMART Domains Protein: ENSMUSP00000020707
Gene: ENSMUSG00000010803

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 41 249 1.5e-52 PFAM
Pfam:Neur_chan_memb 256 347 8.6e-33 PFAM
low complexity region 395 411 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132971
AA Change: V5E
SMART Domains Protein: ENSMUSP00000126611
Gene: ENSMUSG00000010803
AA Change: V5E

DomainStartEndE-ValueType
low complexity region 50 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153147
SMART Domains Protein: ENSMUSP00000129056
Gene: ENSMUSG00000010803

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 46 84 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169305
Predicted Effect probably benign
Transcript: ENSMUST00000205546
Predicted Effect probably benign
Transcript: ENSMUST00000206085
Predicted Effect probably benign
Transcript: ENSMUST00000206105
Predicted Effect probably benign
Transcript: ENSMUST00000207274
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knockout alleles or ones with various nucleotide substitutions exhibit altered life span, abnormal response to benzodiazepines and imidazopyridines, abnormal behaviors and abnormal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Gabra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Gabra1 APN 11 42133626 missense probably benign 0.06
IGL01645:Gabra1 APN 11 42135562 missense probably damaging 1.00
IGL01893:Gabra1 APN 11 42133759 missense possibly damaging 0.80
IGL02114:Gabra1 APN 11 42135575 missense probably damaging 1.00
IGL02378:Gabra1 APN 11 42140255 missense probably damaging 1.00
IGL03402:Gabra1 APN 11 42133518 missense probably damaging 0.96
opulence UTSW 11 42162555 missense probably benign 0.08
Splendor UTSW 11 42135443 missense possibly damaging 0.94
R0546:Gabra1 UTSW 11 42162601 missense probably damaging 0.96
R1495:Gabra1 UTSW 11 42154944 missense probably damaging 1.00
R1538:Gabra1 UTSW 11 42140350 missense probably benign 0.19
R1850:Gabra1 UTSW 11 42179576 missense probably benign
R1989:Gabra1 UTSW 11 42155015 missense probably damaging 1.00
R2061:Gabra1 UTSW 11 42133798 unclassified probably benign
R3758:Gabra1 UTSW 11 42175936 missense probably benign 0.25
R4781:Gabra1 UTSW 11 42133661 missense probably damaging 0.98
R4788:Gabra1 UTSW 11 42147153 missense probably damaging 1.00
R5215:Gabra1 UTSW 11 42154828 missense probably damaging 1.00
R5306:Gabra1 UTSW 11 42133552 missense probably benign 0.00
R5655:Gabra1 UTSW 11 42182923 splice site probably null
R6273:Gabra1 UTSW 11 42140311 missense probably damaging 0.99
R6289:Gabra1 UTSW 11 42155019 missense probably damaging 0.97
R6298:Gabra1 UTSW 11 42182378 unclassified probably benign
R6475:Gabra1 UTSW 11 42162555 missense probably benign 0.08
R6552:Gabra1 UTSW 11 42147099 missense probably damaging 0.99
R7338:Gabra1 UTSW 11 42182294 missense unknown
R7405:Gabra1 UTSW 11 42155023 missense probably damaging 1.00
R7515:Gabra1 UTSW 11 42154833 missense possibly damaging 0.95
R7725:Gabra1 UTSW 11 42135443 missense possibly damaging 0.94
R7727:Gabra1 UTSW 11 42133591 missense probably damaging 1.00
R8193:Gabra1 UTSW 11 42147141 missense probably damaging 1.00
R8319:Gabra1 UTSW 11 42135488 missense probably damaging 1.00
R8362:Gabra1 UTSW 11 42176004 missense probably benign 0.15
X0066:Gabra1 UTSW 11 42133738 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCATACTCTTCTAAGGTGTGC -3'
(R):5'- TCCGTGTTCGAAAACCTTGC -3'

Sequencing Primer
(F):5'- CTCTTCTAAGGTGTGCTCATTAAAGC -3'
(R):5'- GCTTTTTCAGGACAACGCACG -3'
Posted On2016-12-15