Incidental Mutation 'R5789:Socs3'
ID448228
Institutional Source Beutler Lab
Gene Symbol Socs3
Ensembl Gene ENSMUSG00000053113
Gene Namesuppressor of cytokine signaling 3
SynonymsCish3, SOCS-3, E2a-Pbx1 target gene in fibroblasts 10, STAT-induced STAT inhibitor 3, CIS3, SSI-3, cytokine-inducible SH2 protein 3, EF-10
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117966079-117970047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117967782 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 150 (Q150L)
Ref Sequence ENSEMBL: ENSMUSP00000059129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054002]
PDB Structure
solution structure of mouse socs3 in complex with a phosphopeptide from the gp130 receptor [SOLUTION NMR]
Crystal structure of SOCS3 in complex with gp130(pTyr757) phosphopeptide. [X-RAY DIFFRACTION]
SOCS box elonginBC ternary complex [SOLUTION NMR]
Crystal structure of inhibitory protein SOCS3 in complex with JAK2 kinase domain and fragment of GP130 intracellular domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000054002
AA Change: Q150L

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059129
Gene: ENSMUSG00000053113
AA Change: Q150L

DomainStartEndE-ValueType
SH2 44 133 2.21e-20 SMART
SOCS 180 222 2.66e-14 SMART
SOCS_box 186 221 6.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132295
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene is induced by various cytokines, including IL6, IL10, and interferon (IFN)-gamma. The protein encoded by this gene can bind to JAK2 kinase, and inhibit the activity of JAK2 kinase. Studies of the mouse counterpart of this gene suggested the roles of this gene in the negative regulation of fetal liver hematopoiesis, and placental development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations cause impairment if gene expression show immunological and hematopoetic abnormalities. Complete gene disruption causes lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Socs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1483:Socs3 UTSW 11 117967568 nonsense probably null
R4846:Socs3 UTSW 11 117967828 missense probably benign
R4998:Socs3 UTSW 11 117967716 missense probably damaging 1.00
R7174:Socs3 UTSW 11 117967727 nonsense probably null
R7311:Socs3 UTSW 11 117967788 missense probably benign 0.01
R7620:Socs3 UTSW 11 117967570 missense probably damaging 1.00
R8278:Socs3 UTSW 11 117967652 nonsense probably null
X0063:Socs3 UTSW 11 117967619 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGTCACTTTCTCATAGGAG -3'
(R):5'- AGCGCCACTTCTTCACGTTG -3'

Sequencing Primer
(F):5'- GTCACTTTCTCATAGGAGTCCAGG -3'
(R):5'- TTGAGCGTCAAGACCCAGTC -3'
Posted On2016-12-15