Incidental Mutation 'R5789:Carmil1'
ID448229
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24121848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 318 (S318P)
Ref Sequence ENSEMBL: ENSMUSP00000106028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398]
Predicted Effect probably damaging
Transcript: ENSMUST00000072889
AA Change: S318P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: S318P

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110398
AA Change: S318P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: S318P

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Meta Mutation Damage Score 0.1851 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
R7890:Carmil1 UTSW 13 24013232 missense
R8014:Carmil1 UTSW 13 24036321 missense possibly damaging 0.71
R8068:Carmil1 UTSW 13 24075728 missense probably benign 0.00
R8361:Carmil1 UTSW 13 24067130 critical splice donor site probably null
R8469:Carmil1 UTSW 13 24112028 missense probably damaging 1.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTTCCTGGCTCAAAGC -3'
(R):5'- AAGTACGACCACTTTCCTGAAATC -3'

Sequencing Primer
(F):5'- TCAGAGTTGAATTGTACGAT -3'
(R):5'- GGTGTGTCCTCCTTAAGTA -3'
Posted On2016-12-15