Incidental Mutation 'R5790:Polr3e'
ID 448272
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Name polymerase (RNA) III (DNA directed) polypeptide E
Synonyms RPC5, Sin
MMRRC Submission 043384-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R5790 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 120516967-120546655 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120527190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000146970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
AlphaFold Q9CZT4
Predicted Effect probably damaging
Transcript: ENSMUST00000033173
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: D82G

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106483
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: D82G

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207481
AA Change: D56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 31,051,702 (GRCm39) R633* probably null Het
Ahnak T C 19: 8,992,612 (GRCm39) V4632A probably damaging Het
Asap1 T A 15: 63,966,114 (GRCm39) D997V probably damaging Het
Atad2 T C 15: 57,989,990 (GRCm39) Y162C probably damaging Het
Atp2b2 G T 6: 113,736,270 (GRCm39) S936R probably damaging Het
Bcl11a T A 11: 24,113,650 (GRCm39) L331Q probably damaging Het
C6 T A 15: 4,792,968 (GRCm39) F358I probably damaging Het
Capn15 C T 17: 26,183,521 (GRCm39) S386N probably benign Het
Ccdc66 G A 14: 27,222,404 (GRCm39) T113I possibly damaging Het
Cd200 G T 16: 45,217,621 (GRCm39) H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 (GRCm39) probably null Het
Ces2b C T 8: 105,560,568 (GRCm39) P128S probably damaging Het
Ces3b A T 8: 105,819,270 (GRCm39) Q442L probably damaging Het
Chil4 T C 3: 106,109,894 (GRCm39) H373R probably benign Het
Ciapin1 C A 8: 95,551,811 (GRCm39) probably benign Het
Cnot10 A C 9: 114,454,985 (GRCm39) probably null Het
Cpq A G 15: 33,250,143 (GRCm39) K167E probably damaging Het
Dennd4b T A 3: 90,184,757 (GRCm39) D1118E probably damaging Het
Dnah8 T A 17: 31,093,978 (GRCm39) C4691S probably damaging Het
Dnajc1 A G 2: 18,311,898 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,304,981 (GRCm39) R341H probably damaging Het
Dock10 G T 1: 80,482,887 (GRCm39) T2145K probably benign Het
Eif3b T C 5: 140,427,886 (GRCm39) V736A probably benign Het
Eno1 G T 4: 150,329,710 (GRCm39) V195L probably benign Het
Ewsr1 C T 11: 5,032,263 (GRCm39) probably benign Het
Fbn2 T C 18: 58,209,768 (GRCm39) T1038A probably benign Het
Gabrb1 T C 5: 72,293,827 (GRCm39) I367T possibly damaging Het
Gigyf1 C T 5: 137,522,517 (GRCm39) probably benign Het
Glp2r T A 11: 67,655,625 (GRCm39) Y39F probably damaging Het
Gm10036 T A 18: 15,966,243 (GRCm39) Y131* probably null Het
Gm38706 T C 6: 130,461,961 (GRCm39) noncoding transcript Het
Gna15 G A 10: 81,345,218 (GRCm39) R216C probably damaging Het
Grin3a A G 4: 49,792,717 (GRCm39) F339L probably damaging Het
Grk3 T G 5: 113,114,842 (GRCm39) K126T possibly damaging Het
Hspa1l T C 17: 35,196,216 (GRCm39) V85A probably benign Het
Iqsec1 A T 6: 90,666,862 (GRCm39) L525* probably null Het
Irx3 T C 8: 92,526,304 (GRCm39) T467A probably benign Het
Itga2 G A 13: 115,004,742 (GRCm39) T530I probably benign Het
Lonp2 T C 8: 87,358,118 (GRCm39) V113A probably benign Het
Msx3 C T 7: 139,628,866 (GRCm39) R16H possibly damaging Het
Nek3 C A 8: 22,621,313 (GRCm39) Q405H probably damaging Het
Nek3 T A 8: 22,621,314 (GRCm39) Q403L probably damaging Het
Or2b6 T C 13: 21,823,046 (GRCm39) T216A probably benign Het
Or6c66 A G 10: 129,461,757 (GRCm39) Y58H probably damaging Het
P4ha1 A G 10: 59,190,184 (GRCm39) N367S probably benign Het
Padi6 C A 4: 140,459,569 (GRCm39) G429C probably damaging Het
Pidd1 T C 7: 141,021,305 (GRCm39) probably benign Het
Plekhg5 T C 4: 152,198,392 (GRCm39) V847A probably benign Het
Pomt2 T G 12: 87,174,152 (GRCm39) N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 (GRCm39) probably benign Het
Rbm33 A T 5: 28,544,296 (GRCm39) D184V probably damaging Het
Rims2 A T 15: 39,544,441 (GRCm39) T1431S probably damaging Het
Saal1 T C 7: 46,351,352 (GRCm39) D208G probably damaging Het
Sis T C 3: 72,835,507 (GRCm39) I952V probably benign Het
Slc30a1 T A 1: 191,640,997 (GRCm39) D214E probably benign Het
Slc30a8 T C 15: 52,197,043 (GRCm39) V318A possibly damaging Het
Smarca2 A G 19: 26,654,124 (GRCm39) T770A probably damaging Het
Sptbn4 T A 7: 27,065,853 (GRCm39) H2031L probably damaging Het
Ssbp1 A G 6: 40,457,804 (GRCm39) S141G probably benign Het
Tgm4 A G 9: 122,890,808 (GRCm39) E45G probably damaging Het
Thra T A 11: 98,653,777 (GRCm39) S203T probably benign Het
Tle2 T C 10: 81,426,149 (GRCm39) Y763H probably damaging Het
Tmem141 T A 2: 25,511,087 (GRCm39) I102L probably benign Het
Tmem63c C T 12: 87,104,410 (GRCm39) T77I probably benign Het
Tspo2 C A 17: 48,756,047 (GRCm39) probably null Het
Ttc19 T A 11: 62,172,340 (GRCm39) M1K probably null Het
Ucp1 A G 8: 84,024,520 (GRCm39) N282D possibly damaging Het
Vmn1r33 A T 6: 66,589,198 (GRCm39) F119I probably benign Het
Vmn2r24 A T 6: 123,792,499 (GRCm39) M609L probably benign Het
Vwc2l A T 1: 70,790,142 (GRCm39) H146L probably damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120,540,034 (GRCm39) nonsense probably null
IGL01664:Polr3e APN 7 120,530,540 (GRCm39) splice site probably benign
IGL01980:Polr3e APN 7 120,539,519 (GRCm39) splice site probably benign
IGL02027:Polr3e APN 7 120,530,186 (GRCm39) missense probably damaging 1.00
IGL02208:Polr3e APN 7 120,531,363 (GRCm39) missense probably damaging 0.99
IGL02549:Polr3e APN 7 120,538,982 (GRCm39) missense probably damaging 1.00
IGL03338:Polr3e APN 7 120,536,843 (GRCm39) missense probably benign 0.06
R1192:Polr3e UTSW 7 120,532,531 (GRCm39) missense probably benign 0.03
R1328:Polr3e UTSW 7 120,533,046 (GRCm39) splice site probably benign
R1435:Polr3e UTSW 7 120,540,011 (GRCm39) missense probably benign 0.16
R1528:Polr3e UTSW 7 120,539,820 (GRCm39) missense probably damaging 1.00
R1754:Polr3e UTSW 7 120,538,521 (GRCm39) critical splice donor site probably null
R1924:Polr3e UTSW 7 120,539,820 (GRCm39) missense probably damaging 1.00
R2169:Polr3e UTSW 7 120,531,360 (GRCm39) missense probably damaging 1.00
R2201:Polr3e UTSW 7 120,531,465 (GRCm39) missense probably benign
R2362:Polr3e UTSW 7 120,541,787 (GRCm39) missense probably damaging 1.00
R2696:Polr3e UTSW 7 120,532,600 (GRCm39) missense probably damaging 1.00
R4416:Polr3e UTSW 7 120,538,280 (GRCm39) critical splice donor site probably null
R5278:Polr3e UTSW 7 120,522,184 (GRCm39) missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120,522,172 (GRCm39) missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120,539,912 (GRCm39) missense possibly damaging 0.82
R6242:Polr3e UTSW 7 120,539,690 (GRCm39) missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120,527,205 (GRCm39) missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120,527,222 (GRCm39) missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120,543,873 (GRCm39) missense probably damaging 0.98
R7110:Polr3e UTSW 7 120,539,510 (GRCm39) splice site probably null
R7771:Polr3e UTSW 7 120,539,801 (GRCm39) missense probably benign
R7809:Polr3e UTSW 7 120,523,449 (GRCm39) missense probably damaging 1.00
R8431:Polr3e UTSW 7 120,530,528 (GRCm39) missense probably damaging 0.99
R8753:Polr3e UTSW 7 120,539,540 (GRCm39) missense possibly damaging 0.55
R9038:Polr3e UTSW 7 120,536,906 (GRCm39) missense possibly damaging 0.91
R9049:Polr3e UTSW 7 120,538,462 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGGGAAGGACACTGGTCAC -3'
(R):5'- CTGGGATAAGCCAACGTAGG -3'

Sequencing Primer
(F):5'- AAGGACACTGGTCACTCTTG -3'
(R):5'- CCAACAACACTCTTGGTTAACGGTAG -3'
Posted On 2016-12-15