Incidental Mutation 'R5790:Atad2'
ID448303
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene NameATPase family, AAA domain containing 2
Synonyms2610509G12Rik
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58094044-58135082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58126594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 162 (Y162C)
Ref Sequence ENSEMBL: ENSMUSP00000043691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194]
Predicted Effect probably damaging
Transcript: ENSMUST00000038194
AA Change: Y162C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: Y162C

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227171
Meta Mutation Damage Score 0.5518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0310:Atad2 UTSW 15 58114257 missense probably damaging 1.00
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0499:Atad2 UTSW 15 58120949 missense probably benign
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R2158:Atad2 UTSW 15 58098566 missense possibly damaging 0.95
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5247:Atad2 UTSW 15 58104478 nonsense probably null
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R6856:Atad2 UTSW 15 58106813 missense probably damaging 1.00
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
R7421:Atad2 UTSW 15 58134926 missense probably benign 0.40
R7583:Atad2 UTSW 15 58126664 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCAGGAATTTAGCTCAATTG -3'
(R):5'- GCTATGAAAGTTGATGTTCTGTTGCAC -3'

Sequencing Primer
(F):5'- ACACTTTGATCCTAGCACTTGGGAG -3'
(R):5'- GATGTTCTGTTGCACATTTTCAAG -3'
Posted On2016-12-15