Incidental Mutation 'R5790:Fbn2'
ID 448311
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Name fibrillin 2
Synonyms sy, Sne, Fib-2
MMRRC Submission 043384-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R5790 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 58141689-58343200 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58209768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1038 (T1038A)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025497
AA Change: T1038A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: T1038A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 31,051,702 (GRCm39) R633* probably null Het
Ahnak T C 19: 8,992,612 (GRCm39) V4632A probably damaging Het
Asap1 T A 15: 63,966,114 (GRCm39) D997V probably damaging Het
Atad2 T C 15: 57,989,990 (GRCm39) Y162C probably damaging Het
Atp2b2 G T 6: 113,736,270 (GRCm39) S936R probably damaging Het
Bcl11a T A 11: 24,113,650 (GRCm39) L331Q probably damaging Het
C6 T A 15: 4,792,968 (GRCm39) F358I probably damaging Het
Capn15 C T 17: 26,183,521 (GRCm39) S386N probably benign Het
Ccdc66 G A 14: 27,222,404 (GRCm39) T113I possibly damaging Het
Cd200 G T 16: 45,217,621 (GRCm39) H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 (GRCm39) probably null Het
Ces2b C T 8: 105,560,568 (GRCm39) P128S probably damaging Het
Ces3b A T 8: 105,819,270 (GRCm39) Q442L probably damaging Het
Chil4 T C 3: 106,109,894 (GRCm39) H373R probably benign Het
Ciapin1 C A 8: 95,551,811 (GRCm39) probably benign Het
Cnot10 A C 9: 114,454,985 (GRCm39) probably null Het
Cpq A G 15: 33,250,143 (GRCm39) K167E probably damaging Het
Dennd4b T A 3: 90,184,757 (GRCm39) D1118E probably damaging Het
Dnah8 T A 17: 31,093,978 (GRCm39) C4691S probably damaging Het
Dnajc1 A G 2: 18,311,898 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,304,981 (GRCm39) R341H probably damaging Het
Dock10 G T 1: 80,482,887 (GRCm39) T2145K probably benign Het
Eif3b T C 5: 140,427,886 (GRCm39) V736A probably benign Het
Eno1 G T 4: 150,329,710 (GRCm39) V195L probably benign Het
Ewsr1 C T 11: 5,032,263 (GRCm39) probably benign Het
Gabrb1 T C 5: 72,293,827 (GRCm39) I367T possibly damaging Het
Gigyf1 C T 5: 137,522,517 (GRCm39) probably benign Het
Glp2r T A 11: 67,655,625 (GRCm39) Y39F probably damaging Het
Gm10036 T A 18: 15,966,243 (GRCm39) Y131* probably null Het
Gm38706 T C 6: 130,461,961 (GRCm39) noncoding transcript Het
Gna15 G A 10: 81,345,218 (GRCm39) R216C probably damaging Het
Grin3a A G 4: 49,792,717 (GRCm39) F339L probably damaging Het
Grk3 T G 5: 113,114,842 (GRCm39) K126T possibly damaging Het
Hspa1l T C 17: 35,196,216 (GRCm39) V85A probably benign Het
Iqsec1 A T 6: 90,666,862 (GRCm39) L525* probably null Het
Irx3 T C 8: 92,526,304 (GRCm39) T467A probably benign Het
Itga2 G A 13: 115,004,742 (GRCm39) T530I probably benign Het
Lonp2 T C 8: 87,358,118 (GRCm39) V113A probably benign Het
Msx3 C T 7: 139,628,866 (GRCm39) R16H possibly damaging Het
Nek3 C A 8: 22,621,313 (GRCm39) Q405H probably damaging Het
Nek3 T A 8: 22,621,314 (GRCm39) Q403L probably damaging Het
Or2b6 T C 13: 21,823,046 (GRCm39) T216A probably benign Het
Or6c66 A G 10: 129,461,757 (GRCm39) Y58H probably damaging Het
P4ha1 A G 10: 59,190,184 (GRCm39) N367S probably benign Het
Padi6 C A 4: 140,459,569 (GRCm39) G429C probably damaging Het
Pidd1 T C 7: 141,021,305 (GRCm39) probably benign Het
Plekhg5 T C 4: 152,198,392 (GRCm39) V847A probably benign Het
Polr3e A G 7: 120,527,190 (GRCm39) D56G probably damaging Het
Pomt2 T G 12: 87,174,152 (GRCm39) N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 (GRCm39) probably benign Het
Rbm33 A T 5: 28,544,296 (GRCm39) D184V probably damaging Het
Rims2 A T 15: 39,544,441 (GRCm39) T1431S probably damaging Het
Saal1 T C 7: 46,351,352 (GRCm39) D208G probably damaging Het
Sis T C 3: 72,835,507 (GRCm39) I952V probably benign Het
Slc30a1 T A 1: 191,640,997 (GRCm39) D214E probably benign Het
Slc30a8 T C 15: 52,197,043 (GRCm39) V318A possibly damaging Het
Smarca2 A G 19: 26,654,124 (GRCm39) T770A probably damaging Het
Sptbn4 T A 7: 27,065,853 (GRCm39) H2031L probably damaging Het
Ssbp1 A G 6: 40,457,804 (GRCm39) S141G probably benign Het
Tgm4 A G 9: 122,890,808 (GRCm39) E45G probably damaging Het
Thra T A 11: 98,653,777 (GRCm39) S203T probably benign Het
Tle2 T C 10: 81,426,149 (GRCm39) Y763H probably damaging Het
Tmem141 T A 2: 25,511,087 (GRCm39) I102L probably benign Het
Tmem63c C T 12: 87,104,410 (GRCm39) T77I probably benign Het
Tspo2 C A 17: 48,756,047 (GRCm39) probably null Het
Ttc19 T A 11: 62,172,340 (GRCm39) M1K probably null Het
Ucp1 A G 8: 84,024,520 (GRCm39) N282D possibly damaging Het
Vmn1r33 A T 6: 66,589,198 (GRCm39) F119I probably benign Het
Vmn2r24 A T 6: 123,792,499 (GRCm39) M609L probably benign Het
Vwc2l A T 1: 70,790,142 (GRCm39) H146L probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58,170,881 (GRCm39) missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58,229,060 (GRCm39) missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58,145,397 (GRCm39) missense probably benign 0.00
IGL01011:Fbn2 APN 18 58,228,312 (GRCm39) splice site probably benign
IGL01123:Fbn2 APN 18 58,237,153 (GRCm39) missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58,194,817 (GRCm39) missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58,246,442 (GRCm39) missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58,336,905 (GRCm39) missense probably null 0.67
IGL01608:Fbn2 APN 18 58,186,776 (GRCm39) nonsense probably null
IGL01682:Fbn2 APN 18 58,205,743 (GRCm39) missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58,209,049 (GRCm39) splice site probably null
IGL01764:Fbn2 APN 18 58,178,423 (GRCm39) missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58,247,625 (GRCm39) missense probably benign 0.01
IGL02010:Fbn2 APN 18 58,170,794 (GRCm39) missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58,342,675 (GRCm39) missense probably benign 0.04
IGL02037:Fbn2 APN 18 58,229,087 (GRCm39) missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58,237,067 (GRCm39) missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58,237,067 (GRCm39) missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58,209,777 (GRCm39) missense probably benign
IGL03233:Fbn2 APN 18 58,235,449 (GRCm39) missense probably benign 0.39
IGL03347:Fbn2 APN 18 58,146,737 (GRCm39) missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58,183,315 (GRCm39) missense possibly damaging 0.95
pinch UTSW 18 58,202,256 (GRCm39) missense probably damaging 1.00
stick UTSW 18 58,204,891 (GRCm39) missense possibly damaging 0.94
tweak UTSW 18 58,191,461 (GRCm39) missense probably damaging 1.00
BB009:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
BB019:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
PIT4434001:Fbn2 UTSW 18 58,229,134 (GRCm39) missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58,238,236 (GRCm39) missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58,202,256 (GRCm39) missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58,189,275 (GRCm39) missense probably benign 0.00
R0116:Fbn2 UTSW 18 58,235,445 (GRCm39) nonsense probably null
R0277:Fbn2 UTSW 18 58,178,389 (GRCm39) missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58,183,362 (GRCm39) splice site probably benign
R0316:Fbn2 UTSW 18 58,246,397 (GRCm39) missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58,178,389 (GRCm39) missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58,160,876 (GRCm39) splice site probably benign
R0455:Fbn2 UTSW 18 58,168,408 (GRCm39) missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58,172,532 (GRCm39) missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58,146,821 (GRCm39) missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58,170,819 (GRCm39) missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58,178,446 (GRCm39) missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58,191,461 (GRCm39) missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58,145,425 (GRCm39) missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58,203,088 (GRCm39) missense probably benign 0.00
R1319:Fbn2 UTSW 18 58,333,682 (GRCm39) missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58,213,265 (GRCm39) missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58,186,731 (GRCm39) missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58,143,452 (GRCm39) missense probably benign
R1612:Fbn2 UTSW 18 58,194,824 (GRCm39) missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58,181,620 (GRCm39) missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58,159,610 (GRCm39) missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58,191,534 (GRCm39) missense probably benign 0.41
R1722:Fbn2 UTSW 18 58,181,124 (GRCm39) critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58,183,348 (GRCm39) missense probably benign 0.35
R1802:Fbn2 UTSW 18 58,186,048 (GRCm39) nonsense probably null
R1850:Fbn2 UTSW 18 58,172,377 (GRCm39) splice site probably benign
R1913:Fbn2 UTSW 18 58,194,814 (GRCm39) missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58,223,730 (GRCm39) missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58,181,921 (GRCm39) missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58,186,065 (GRCm39) missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58,186,065 (GRCm39) missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58,235,397 (GRCm39) splice site probably null
R2207:Fbn2 UTSW 18 58,214,471 (GRCm39) nonsense probably null
R2219:Fbn2 UTSW 18 58,186,035 (GRCm39) missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58,228,248 (GRCm39) splice site probably benign
R2375:Fbn2 UTSW 18 58,169,038 (GRCm39) missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58,336,859 (GRCm39) missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58,226,431 (GRCm39) missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58,202,314 (GRCm39) missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58,226,459 (GRCm39) missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58,282,122 (GRCm39) missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58,194,814 (GRCm39) missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58,199,083 (GRCm39) missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58,186,841 (GRCm39) missense probably benign 0.01
R4133:Fbn2 UTSW 18 58,229,034 (GRCm39) missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58,156,359 (GRCm39) nonsense probably null
R4288:Fbn2 UTSW 18 58,168,411 (GRCm39) missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58,168,411 (GRCm39) missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58,282,122 (GRCm39) missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58,209,146 (GRCm39) missense probably benign 0.00
R4601:Fbn2 UTSW 18 58,186,805 (GRCm39) missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58,323,341 (GRCm39) nonsense probably null
R4626:Fbn2 UTSW 18 58,146,819 (GRCm39) nonsense probably null
R4638:Fbn2 UTSW 18 58,143,376 (GRCm39) missense probably benign 0.01
R4675:Fbn2 UTSW 18 58,173,265 (GRCm39) missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58,189,344 (GRCm39) missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58,159,458 (GRCm39) missense probably benign 0.00
R4945:Fbn2 UTSW 18 58,183,325 (GRCm39) missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58,191,455 (GRCm39) missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58,143,703 (GRCm39) missense probably benign 0.05
R4998:Fbn2 UTSW 18 58,205,703 (GRCm39) missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58,172,412 (GRCm39) missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58,172,387 (GRCm39) missense probably benign 0.00
R5414:Fbn2 UTSW 18 58,226,477 (GRCm39) missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58,204,973 (GRCm39) missense probably benign 0.22
R5557:Fbn2 UTSW 18 58,248,731 (GRCm39) missense probably benign 0.00
R5754:Fbn2 UTSW 18 58,257,383 (GRCm39) missense probably benign 0.04
R5769:Fbn2 UTSW 18 58,238,271 (GRCm39) missense probably damaging 1.00
R5830:Fbn2 UTSW 18 58,247,541 (GRCm39) missense probably benign 0.01
R5845:Fbn2 UTSW 18 58,186,840 (GRCm39) missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58,156,354 (GRCm39) nonsense probably null
R5907:Fbn2 UTSW 18 58,178,409 (GRCm39) missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58,170,121 (GRCm39) missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58,177,328 (GRCm39) missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58,181,992 (GRCm39) missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58,202,596 (GRCm39) missense probably benign 0.31
R6024:Fbn2 UTSW 18 58,209,908 (GRCm39) missense probably benign 0.03
R6037:Fbn2 UTSW 18 58,177,295 (GRCm39) missense probably benign 0.05
R6037:Fbn2 UTSW 18 58,177,295 (GRCm39) missense probably benign 0.05
R6315:Fbn2 UTSW 18 58,188,025 (GRCm39) critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58,246,435 (GRCm39) missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58,196,647 (GRCm39) missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58,235,462 (GRCm39) missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58,169,032 (GRCm39) missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58,246,405 (GRCm39) missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58,143,686 (GRCm39) missense probably benign 0.00
R6801:Fbn2 UTSW 18 58,246,420 (GRCm39) missense probably benign 0.04
R6862:Fbn2 UTSW 18 58,257,393 (GRCm39) missense probably benign 0.04
R6900:Fbn2 UTSW 18 58,209,903 (GRCm39) missense probably benign
R6906:Fbn2 UTSW 18 58,204,891 (GRCm39) missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58,257,259 (GRCm39) splice site probably null
R6950:Fbn2 UTSW 18 58,168,993 (GRCm39) missense probably null 0.21
R6985:Fbn2 UTSW 18 58,201,460 (GRCm39) missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58,209,798 (GRCm39) missense probably benign
R7199:Fbn2 UTSW 18 58,186,833 (GRCm39) nonsense probably null
R7219:Fbn2 UTSW 18 58,186,099 (GRCm39) missense probably benign 0.04
R7226:Fbn2 UTSW 18 58,170,142 (GRCm39) missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58,199,188 (GRCm39) missense probably benign 0.14
R7414:Fbn2 UTSW 18 58,229,122 (GRCm39) missense probably damaging 1.00
R7485:Fbn2 UTSW 18 58,204,912 (GRCm39) missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58,199,152 (GRCm39) missense probably benign 0.01
R7549:Fbn2 UTSW 18 58,153,536 (GRCm39) nonsense probably null
R7619:Fbn2 UTSW 18 58,213,299 (GRCm39) missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58,238,208 (GRCm39) missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58,172,385 (GRCm39) missense probably benign 0.22
R7932:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
R8013:Fbn2 UTSW 18 58,237,153 (GRCm39) missense possibly damaging 0.62
R8076:Fbn2 UTSW 18 58,159,496 (GRCm39) nonsense probably null
R8300:Fbn2 UTSW 18 58,342,687 (GRCm39) missense probably benign
R8345:Fbn2 UTSW 18 58,191,503 (GRCm39) missense probably damaging 1.00
R8487:Fbn2 UTSW 18 58,153,462 (GRCm39) missense possibly damaging 0.53
R8520:Fbn2 UTSW 18 58,171,270 (GRCm39) critical splice donor site probably null
R8781:Fbn2 UTSW 18 58,194,719 (GRCm39) missense possibly damaging 0.88
R8801:Fbn2 UTSW 18 58,287,021 (GRCm39) missense probably damaging 1.00
R8857:Fbn2 UTSW 18 58,286,933 (GRCm39) missense probably damaging 1.00
R8878:Fbn2 UTSW 18 58,257,318 (GRCm39) missense probably benign 0.30
R8909:Fbn2 UTSW 18 58,192,508 (GRCm39) missense possibly damaging 0.88
R8973:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8975:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8979:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8991:Fbn2 UTSW 18 58,239,395 (GRCm39) missense probably damaging 1.00
R9003:Fbn2 UTSW 18 58,176,591 (GRCm39) missense probably damaging 1.00
R9205:Fbn2 UTSW 18 58,192,428 (GRCm39) missense probably damaging 1.00
R9215:Fbn2 UTSW 18 58,209,747 (GRCm39) missense probably damaging 1.00
R9263:Fbn2 UTSW 18 58,257,344 (GRCm39) missense probably damaging 1.00
R9307:Fbn2 UTSW 18 58,342,856 (GRCm39) missense probably benign
R9337:Fbn2 UTSW 18 58,342,723 (GRCm39) missense probably benign
R9403:Fbn2 UTSW 18 58,199,179 (GRCm39) missense probably damaging 1.00
R9501:Fbn2 UTSW 18 58,209,130 (GRCm39) missense probably damaging 1.00
R9503:Fbn2 UTSW 18 58,171,313 (GRCm39) missense probably damaging 1.00
R9509:Fbn2 UTSW 18 58,247,550 (GRCm39) missense probably benign 0.22
R9561:Fbn2 UTSW 18 58,181,611 (GRCm39) nonsense probably null
R9565:Fbn2 UTSW 18 58,228,298 (GRCm39) missense probably benign 0.20
R9652:Fbn2 UTSW 18 58,146,722 (GRCm39) critical splice donor site probably null
R9659:Fbn2 UTSW 18 58,342,654 (GRCm39) missense probably damaging 0.98
R9679:Fbn2 UTSW 18 58,201,433 (GRCm39) missense probably damaging 1.00
R9683:Fbn2 UTSW 18 58,186,099 (GRCm39) missense probably benign 0.04
R9773:Fbn2 UTSW 18 58,143,481 (GRCm39) missense probably benign
X0062:Fbn2 UTSW 18 58,189,285 (GRCm39) missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58,202,262 (GRCm39) missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58,188,554 (GRCm39) missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58,143,451 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGACCTTAGGTTGGCCAC -3'
(R):5'- AGGATGCTCAGTGAGTGCTC -3'

Sequencing Primer
(F):5'- GGCCACCAATGATATGTTGAAAAC -3'
(R):5'- TCAGTGAGTGCTCCCGCTC -3'
Posted On 2016-12-15