Mutagenetix > Incidental Mutations

Incidental Mutation 'R5790:Smarca2'

448313

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

MMRRC Submission

043384-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5790 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26605050-26778322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26676724 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 770 (T770A)

Ref Sequence

ENSEMBL: ENSMUSP00000135017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025862
AA Change: T770A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: T770A

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099537
AA Change: T770A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: T770A

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176019

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176030
AA Change: T770A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: T770A

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176769
AA Change: T770A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: T770A

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208303
AA Change: T95A

Meta Mutation Damage Score

0.5474

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl5	A	T	5: 30,894,358	R633*	probably null	Het
Ahnak	T	C	19: 9,015,248	V4632A	probably damaging	Het
Asap1	T	A	15: 64,094,265	D997V	probably damaging	Het
Atad2	T	C	15: 58,126,594	Y162C	probably damaging	Het
Atp2b2	G	T	6: 113,759,309	S936R	probably damaging	Het
Bcl11a	T	A	11: 24,163,650	L331Q	probably damaging	Het
C6	T	A	15: 4,763,486	F358I	probably damaging	Het
Capn15	C	T	17: 25,964,547	S386N	probably benign	Het
Ccdc66	G	A	14: 27,500,447	T113I	possibly damaging	Het
Cd200	G	T	16: 45,397,258	H23Q	possibly damaging	Het
Cdh17	A	G	4: 11,814,945		probably null	Het
Ces2b	C	T	8: 104,833,936	P128S	probably damaging	Het
Ces3b	A	T	8: 105,092,638	Q442L	probably damaging	Het
Chil4	T	C	3: 106,202,578	H373R	probably benign	Het
Ciapin1	C	A	8: 94,825,183		probably benign	Het
Cnot10	A	C	9: 114,625,917		probably null	Het
Cpq	A	G	15: 33,249,997	K167E	probably damaging	Het
Dennd4b	T	A	3: 90,277,450	D1118E	probably damaging	Het
Dnah8	T	A	17: 30,875,004	C4691S	probably damaging	Het
Dnajc1	A	G	2: 18,307,087		probably benign	Het
Dnhd1	G	A	7: 105,655,774	R341H	probably damaging	Het
Dock10	G	T	1: 80,505,170	T2145K	probably benign	Het
Eif3b	T	C	5: 140,442,131	V736A	probably benign	Het
Eno1	G	T	4: 150,245,253	V195L	probably benign	Het
Ewsr1	C	T	11: 5,082,263		probably benign	Het
Fbn2	T	C	18: 58,076,696	T1038A	probably benign	Het
Gabrb1	T	C	5: 72,136,484	I367T	possibly damaging	Het
Gigyf1	C	T	5: 137,524,255		probably benign	Het
Glp2r	T	A	11: 67,764,799	Y39F	probably damaging	Het
Gm10036	T	A	18: 15,833,186	Y131*	probably null	Het
Gm38706	T	C	6: 130,484,998		noncoding transcript	Het
Gna15	G	A	10: 81,509,384	R216C	probably damaging	Het
Grin3a	A	G	4: 49,792,717	F339L	probably damaging	Het
Grk3	T	G	5: 112,966,976	K126T	possibly damaging	Het
Hspa1l	T	C	17: 34,977,240	V85A	probably benign	Het
Iqsec1	A	T	6: 90,689,880	L525*	probably null	Het
Irx3	T	C	8: 91,799,676	T467A	probably benign	Het
Itga2	G	A	13: 114,868,206	T530I	probably benign	Het
Lonp2	T	C	8: 86,631,490	V113A	probably benign	Het
Msx3	C	T	7: 140,048,953	R16H	possibly damaging	Het
Nek3	C	A	8: 22,131,297	Q405H	probably damaging	Het
Nek3	T	A	8: 22,131,298	Q403L	probably damaging	Het
Olfr11	T	C	13: 21,638,876	T216A	probably benign	Het
Olfr798	A	G	10: 129,625,888	Y58H	probably damaging	Het
P4ha1	A	G	10: 59,354,362	N367S	probably benign	Het
Padi6	C	A	4: 140,732,258	G429C	probably damaging	Het
Pidd1	T	C	7: 141,441,392		probably benign	Het
Plekhg5	T	C	4: 152,113,935	V847A	probably benign	Het
Polr3e	A	G	7: 120,927,967	D56G	probably damaging	Het
Pomt2	T	G	12: 87,127,378	N347T	probably damaging	Het
Ppp1r9a	T	C	6: 5,134,363		probably benign	Het
Rbm33	A	T	5: 28,339,298	D184V	probably damaging	Het
Rims2	A	T	15: 39,681,045	T1431S	probably damaging	Het
Saal1	T	C	7: 46,701,928	D208G	probably damaging	Het
Sis	T	C	3: 72,928,174	I952V	probably benign	Het
Slc30a1	T	A	1: 191,908,885	D214E	probably benign	Het
Slc30a8	T	C	15: 52,333,647	V318A	possibly damaging	Het
Sptbn4	T	A	7: 27,366,428	H2031L	probably damaging	Het
Ssbp1	A	G	6: 40,480,870	S141G	probably benign	Het
Tgm4	A	G	9: 123,061,743	E45G	probably damaging	Het
Thra	T	A	11: 98,762,951	S203T	probably benign	Het
Tle2	T	C	10: 81,590,315	Y763H	probably damaging	Het
Tmem141	T	A	2: 25,621,075	I102L	probably benign	Het
Tmem63c	C	T	12: 87,057,636	T77I	probably benign	Het
Tspo2	C	A	17: 48,449,019		probably null	Het
Ttc19	T	A	11: 62,281,514	M1K	probably null	Het
Ucp1	A	G	8: 83,297,891	N282D	possibly damaging	Het
Vmn1r33	A	T	6: 66,612,214	F119I	probably benign	Het
Vmn2r24	A	T	6: 123,815,540	M609L	probably benign	Het
Vwc2l	A	T	1: 70,750,983	H146L	probably damaging	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26774294	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26698465	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26716137	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26672740	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26716182	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26640586	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26676624	splice site	probably benign
IGL03028:Smarca2	APN	19	26678312	splice site	probably benign
IGL03187:Smarca2	APN	19	26672824	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26623975	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26619903	missense	probably benign	0.01
FR4737:Smarca2	UTSW	19	26630999	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26649093	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26692249	nonsense	probably null
R0306:Smarca2	UTSW	19	26640613	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26691362	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26681875	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26691391	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26706200	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26698403	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26770933	splice site	probably benign
R1256:Smarca2	UTSW	19	26681973	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26771611	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26770988	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26630828	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26676740	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26710684	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26631101	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26751905	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26640380	splice site	probably benign
R1861:Smarca2	UTSW	19	26623884	missense	probably benign	0.03
R1962:Smarca2	UTSW	19	26672724	nonsense	probably null
R1964:Smarca2	UTSW	19	26672724	nonsense	probably null
R1998:Smarca2	UTSW	19	26631093	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26683905	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26771038	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26640650	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26691454	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26752029	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26683822	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26668890	unclassified	probably benign
R3845:Smarca2	UTSW	19	26720873	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26683927	splice site	probably null
R4014:Smarca2	UTSW	19	26683927	splice site	probably null
R4016:Smarca2	UTSW	19	26683927	splice site	probably null
R4271:Smarca2	UTSW	19	26720949	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26619877	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26776225	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26630673	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26654483	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26720855	nonsense	probably null
R5015:Smarca2	UTSW	19	26691388	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26691372	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26640429	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26623936	missense	probably damaging	0.96
R5503:Smarca2	UTSW	19	26682046	missense	possibly damaging	0.93
R5715:Smarca2	UTSW	19	26649122	missense	probably benign	0.16
R5874:Smarca2	UTSW	19	26776069	intron	probably benign
R6209:Smarca2	UTSW	19	26771004	nonsense	probably null
R6236:Smarca2	UTSW	19	26696213	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26678363	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26630931	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26679173	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26619884	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26654377	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26751886	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26669155	missense	possibly damaging	0.83
R7213:Smarca2	UTSW	19	26647131	missense	possibly damaging	0.96
R7257:Smarca2	UTSW	19	26654464	nonsense	probably null
R7259:Smarca2	UTSW	19	26654464	nonsense	probably null
R7479:Smarca2	UTSW	19	26640487	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26683809	missense	possibly damaging	0.51
X0061:Smarca2	UTSW	19	26720840	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAAGGAAGTCACAGGCTCACTTG -3'
(R):5'- GTGGGAAACTAAAACCGACATTCC -3'

Sequencing Primer
(F):5'- AAGTCACAGGCTCACTTGAGTTG -3'
(R):5'- AAACCGACATTCCTTCAGATTCTGTG -3'

Posted On

2016-12-15