Mutagenetix > Incidental Mutation

Incidental Mutation 'R5801:Slco6b1'

448318

Institutional Source

Beutler Lab

Gene Symbol

Slco6b1

Ensembl Gene

ENSMUSG00000045463

Gene Name

solute carrier organic anion transporter family, member 6b1

Synonyms

1700022M03Rik

MMRRC Submission

043390-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5801 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96906176-96997577 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

C to T at 96947631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178359

SMART Domains

Protein: ENSMUSP00000136663
Gene: ENSMUSG00000045463

Domain	Start	End	E-Value	Type
Pfam:MFS_1	103	481	1.6e-12	PFAM
Pfam:OATP	108	668	9.7e-128	PFAM
Pfam:Kazal_2	511	552	5.1e-8	PFAM
transmembrane domain	670	692	N/A	INTRINSIC

Meta Mutation Damage Score

0.8597

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (75/75)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	C	T	3: 89,342,361	V667I	probably damaging	Het
Adamts14	T	C	10: 61,202,996	S912G	probably damaging	Het
Adamts20	C	A	15: 94,347,670	E584*	probably null	Het
Ago3	A	T	4: 126,371,768	N284K	possibly damaging	Het
Alx3	T	A	3: 107,604,941	Y298*	probably null	Het
Arhgap32	A	G	9: 32,255,788	I574V	probably benign	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Caskin2	T	C	11: 115,803,473	D400G	probably damaging	Het
Cdc73	T	A	1: 143,608,543	H525L	probably benign	Het
Cep135	A	G	5: 76,630,676	E674G	probably damaging	Het
Cic	G	A	7: 25,271,438	R198Q	possibly damaging	Het
Col5a2	T	C	1: 45,389,481		probably null	Het
Col6a5	A	G	9: 105,948,367	V9A	unknown	Het
Cpsf7	A	T	19: 10,539,632	D366V	probably benign	Het
Cuedc2	T	C	19: 46,331,357	E173G	probably damaging	Het
D5Ertd579e	T	C	5: 36,604,569	E1318G	probably damaging	Het
Ddx55	T	C	5: 124,566,497		probably null	Het
Dennd1b	T	A	1: 139,039,989		probably null	Het
Dpy19l3	T	C	7: 35,725,298	T111A	probably benign	Het
Edn1	C	A	13: 42,306,806	A179E	probably benign	Het
Eif2b1	T	C	5: 124,574,712		probably null	Het
Epha5	A	G	5: 84,331,226		probably null	Het
Erc1	T	A	6: 119,773,822	N466I	probably damaging	Het
Ermp1	A	G	19: 29,612,828	F825L	probably damaging	Het
Fbxo18	T	C	2: 11,769,826	D36G	probably damaging	Het
Fbxo41	G	T	6: 85,484,533	F64L	probably damaging	Het
Gabrb2	T	C	11: 42,421,389	S14P	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm6505	A	T	3: 28,764,967		noncoding transcript	Het
Ighv1-18	T	A	12: 114,682,708	D91V	probably damaging	Het
Imp3	A	G	9: 56,937,802	D99G	probably benign	Het
Iqub	T	C	6: 24,449,769	K699R	probably benign	Het
Itpk1	A	G	12: 102,573,945	V293A	probably damaging	Het
Lrrc49	A	T	9: 60,602,633	F157L	probably damaging	Het
Mapk1ip1	T	A	7: 138,836,510	T64S	possibly damaging	Het
Mrpl9	T	C	3: 94,447,796	L225P	possibly damaging	Het
Ms4a14	A	G	19: 11,301,786	L1136S	possibly damaging	Het
Ms4a14	A	T	19: 11,301,882	I1104K	possibly damaging	Het
Nkain2	T	C	10: 32,402,268	T54A	probably damaging	Het
Ociad2	A	G	5: 73,326,299	F60S	probably damaging	Het
Olfr397	T	C	11: 73,964,946	F113L	probably benign	Het
Polk	T	A	13: 96,483,586	H723L	probably damaging	Het
Prickle4	C	A	17: 47,688,773	R285L	possibly damaging	Het
Psmd2	A	G	16: 20,654,922	N121S	probably damaging	Het
Rab11fip5	T	A	6: 85,337,600	S1212C	probably damaging	Het
Rasgef1c	T	G	11: 49,970,056	M266R	probably damaging	Het
Rpusd4	A	G	9: 35,270,073	E155G	possibly damaging	Het
Rrbp1	A	G	2: 143,989,783	S155P	probably damaging	Het
Safb2	T	C	17: 56,563,103	Y991C	possibly damaging	Het
Shank1	G	A	7: 44,356,816	E1986K	possibly damaging	Het
Slc22a14	A	G	9: 119,172,083	F482L	probably benign	Het
Slc35e3	T	A	10: 117,745,862	M109L	probably benign	Het
Slco4c1	T	C	1: 96,872,084	N9S	probably damaging	Het
Sptan1	A	G	2: 30,030,601		probably null	Het
Sptlc2	T	C	12: 87,341,771		probably null	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Strip1	A	C	3: 107,621,441	L391R	possibly damaging	Het
Tacr1	T	A	6: 82,557,153	S387T	probably benign	Het
Thbs2	A	T	17: 14,687,863	F213I	probably damaging	Het
Thbs3	A	T	3: 89,224,397	Y692F	probably benign	Het
Tktl2	C	A	8: 66,513,647	A619E	probably benign	Het
Tmc3	A	T	7: 83,622,478	E946V	possibly damaging	Het
Tmem132d	A	G	5: 127,784,900	V719A	possibly damaging	Het
Trpa1	T	C	1: 14,898,078	H488R	probably damaging	Het
Tsfm	TCACTCC	TCACTCCACTCC	10: 127,022,837		probably null	Het
Wdr35	A	G	12: 9,006,723	T503A	possibly damaging	Het
Zfp109	T	C	7: 24,228,701	K436E	probably damaging	Het
Zfp423	A	G	8: 87,859,362	Y78H	probably damaging	Het
Zfp970	A	G	2: 177,473,358	K26E	probably damaging	Het

Other mutations in Slco6b1

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00434:Slco6b1	APN	1	96988650	exon	noncoding transcript
IGL02110:Slco6b1	APN	1	96987882	exon	noncoding transcript
IGL02416:Slco6b1	APN	1	96924333	exon	noncoding transcript
IGL03406:Slco6b1	APN	1	96947585	exon	noncoding transcript
R0147:Slco6b1	UTSW	1	96987837	exon	noncoding transcript
R0277:Slco6b1	UTSW	1	96988673	exon	noncoding transcript
R0513:Slco6b1	UTSW	1	96997184	unclassified	noncoding transcript
R1401:Slco6b1	UTSW	1	96929885	splice site	noncoding transcript
R1823:Slco6b1	UTSW	1	96961176	exon	noncoding transcript
R1888:Slco6b1	UTSW	1	96922061	splice site	noncoding transcript
R4125:Slco6b1	UTSW	1	96987897	exon	noncoding transcript
R4281:Slco6b1	UTSW	1	96997390	unclassified	noncoding transcript
R4282:Slco6b1	UTSW	1	96997390	unclassified	noncoding transcript
R4576:Slco6b1	UTSW	1	96988697	exon	noncoding transcript
R4850:Slco6b1	UTSW	1	96911833	unclassified	noncoding transcript
R5222:Slco6b1	UTSW	1	96997491	unclassified	noncoding transcript
R5389:Slco6b1	UTSW	1	96988584	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- ACGAGTCTGGAAAATATGCCTTC -3'
(R):5'- GCTTCATCCACTTGCACAAGAC -3'

Sequencing Primer
(F):5'- GCAGTGATTCCAGCAAAT -3'
(R):5'- TCCACTTGCACAAGACTGTATG -3'

Posted On

2016-12-15