Incidental Mutation 'R0546:Itgal'
ID44832
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission 038738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R0546 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127310314 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 446 (T446I)
Ref Sequence ENSEMBL: ENSMUSP00000113396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably benign
Transcript: ENSMUST00000106306
AA Change: T446I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: T446I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117762
AA Change: T446I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: T446I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118405
AA Change: T50I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830
AA Change: T50I

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120857
AA Change: T446I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: T446I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170971
AA Change: T446I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: T446I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,077,077 probably null Het
Actn1 C T 12: 80,178,434 R418Q probably benign Het
Adam39 G A 8: 40,826,431 V620M probably damaging Het
Agr3 C A 12: 35,928,330 T14K probably benign Het
Alpk2 T C 18: 65,306,717 D1002G probably benign Het
Amz2 T A 11: 109,433,954 N221K probably benign Het
Aox4 A G 1: 58,250,174 E752G probably damaging Het
Ap2a1 C T 7: 44,904,708 G500S probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc112 A G 18: 46,291,072 S200P possibly damaging Het
Ccdc18 A T 5: 108,174,964 E643D probably benign Het
Ccdc180 A T 4: 45,904,597 T398S possibly damaging Het
Cnp A G 11: 100,580,723 Y397C probably damaging Het
Cpa4 T C 6: 30,580,963 W184R probably damaging Het
Crebbp A T 16: 4,085,807 I1856N probably damaging Het
Ctrl A G 8: 105,932,334 I200T probably damaging Het
Cyfip1 C T 7: 55,922,816 R934* probably null Het
Dennd5a A G 7: 109,921,426 V408A probably benign Het
Dhfr G A 13: 92,368,184 probably null Het
Dnajc6 A T 4: 101,635,191 N740Y probably damaging Het
Fam110a T C 2: 151,970,812 T13A probably benign Het
Fars2 G T 13: 36,204,586 K19N probably benign Het
Fer1l6 A T 15: 58,558,408 probably null Het
Gabra1 T A 11: 42,162,601 T69S probably damaging Het
Galnt18 T G 7: 111,508,141 N475T probably damaging Het
Gbp4 T C 5: 105,120,970 Y439C probably damaging Het
Gpatch2l A G 12: 86,288,848 *409W probably null Het
Hip1r T C 5: 123,999,051 V658A possibly damaging Het
Hspg2 A G 4: 137,502,294 D73G probably benign Het
Ifitm2 A G 7: 140,955,743 V58A possibly damaging Het
Ift172 T C 5: 31,257,601 D1359G probably benign Het
Ing1 A G 8: 11,557,031 D41G probably damaging Het
Itgav G T 2: 83,803,242 M978I probably benign Het
Jazf1 A G 6: 52,777,696 Y132H possibly damaging Het
Lgr4 T A 2: 109,999,421 N211K probably damaging Het
Mgat4d A G 8: 83,355,721 N100S possibly damaging Het
Mrgprb3 T C 7: 48,643,515 Y96C probably damaging Het
Myh11 A C 16: 14,205,628 L1562R probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo15 A G 11: 60,506,313 Y2667C probably damaging Het
Olfr1084 T A 2: 86,639,229 T160S possibly damaging Het
Olfr1085 C T 2: 86,657,891 C189Y possibly damaging Het
Olfr1158 T A 2: 87,990,472 Y120* probably null Het
Olfr128 T A 17: 37,924,338 C257* probably null Het
Olfr608 A G 7: 103,470,700 I220M possibly damaging Het
Olfr814 G A 10: 129,874,538 T73I possibly damaging Het
Paox G T 7: 140,131,678 G148W probably damaging Het
Pkd1 T C 17: 24,580,138 V2777A probably benign Het
Plod2 T A 9: 92,595,335 V360E probably damaging Het
Prune2 T C 19: 17,020,666 probably benign Het
Sbds G T 5: 130,254,078 A3D possibly damaging Het
Sec23a T C 12: 58,985,167 T426A probably benign Het
Sec31a T C 5: 100,404,070 Y148C probably damaging Het
Shprh T A 10: 11,183,887 probably benign Het
Slc16a7 A G 10: 125,230,873 V299A probably benign Het
Smg8 T C 11: 87,083,613 Y174C possibly damaging Het
Snx22 T A 9: 66,068,777 Y58F probably damaging Het
Snx25 A G 8: 46,103,630 Y308H probably benign Het
St3gal2 A G 8: 110,970,106 probably null Het
Stab1 C T 14: 31,139,550 R2500H possibly damaging Het
Steap4 T C 5: 7,975,870 S144P probably damaging Het
Stfa3 T A 16: 36,452,257 probably benign Het
Tmprss9 C A 10: 80,899,323 Q1095K probably benign Het
Top2a A G 11: 98,999,226 V1217A possibly damaging Het
Trhr2 A G 8: 122,358,489 probably null Het
Trim7 A G 11: 48,845,509 E23G probably damaging Het
Trpv3 A T 11: 73,297,187 E788V probably damaging Het
Ttn A G 2: 76,745,519 I25010T probably damaging Het
Ube2ql1 T C 13: 69,739,300 H14R unknown Het
Uggt1 C T 1: 36,195,971 R419H probably benign Het
Xpo4 A G 14: 57,613,274 V391A probably benign Het
Zfhx3 A G 8: 108,794,187 D647G probably damaging Het
Zfp354c A T 11: 50,815,630 M206K probably benign Het
Zfp804a A G 2: 82,258,920 N1031S possibly damaging Het
Zfp868 A G 8: 69,612,231 V151A probably benign Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 splice site probably null
R0350:Itgal UTSW 7 127322081 missense probably damaging 1.00
R0380:Itgal UTSW 7 127310751 nonsense probably null
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1720:Itgal UTSW 7 127306927 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R3925:Itgal UTSW 7 127324537 splice site probably benign
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
R7049:Itgal UTSW 7 127296401 unclassified probably benign
R7168:Itgal UTSW 7 127330213 missense probably benign
R7419:Itgal UTSW 7 127306875 missense probably benign 0.01
R7424:Itgal UTSW 7 127317365 missense probably benign 0.00
R7454:Itgal UTSW 7 127327764 missense probably benign 0.00
R7567:Itgal UTSW 7 127299788 missense probably benign 0.00
R7696:Itgal UTSW 7 127330184 missense probably damaging 1.00
R7977:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R7987:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R8118:Itgal UTSW 7 127311245 missense probably benign 0.08
R8297:Itgal UTSW 7 127330466 missense unknown
R8418:Itgal UTSW 7 127330282 missense probably benign 0.02
R8507:Itgal UTSW 7 127329435 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCGCTTCTAACTCCAGATGCC -3'
(R):5'- TCCGATCTGTGAGGACAGCAAGAC -3'

Sequencing Primer
(F):5'- TAACTCCAGATGCCTCCCCTG -3'
(R):5'- TGCAGAATCAAGTCCTGAGC -3'
Posted On2013-06-11