Incidental Mutation 'R5801:Tacr1'
ID448342
Institutional Source Beutler Lab
Gene Symbol Tacr1
Ensembl Gene ENSMUSG00000030043
Gene Nametachykinin receptor 1
Synonymssubstance p receptor, Tac1r, NK1 receptor, SPr, NK1-R, neurokinin receptor 1, NK-1R
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5801 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location82402334-82560104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82557153 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 387 (S387T)
Ref Sequence ENSEMBL: ENSMUSP00000145217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032122] [ENSMUST00000203775]
Predicted Effect probably benign
Transcript: ENSMUST00000032122
AA Change: S387T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032122
Gene: ENSMUSG00000030043
AA Change: S387T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203775
AA Change: S387T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000145217
Gene: ENSMUSG00000030043
AA Change: S387T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes the receptor for the tachykinin, substance P, also referred to as neurokinin 1. This gene belongs to a gene family of tachykinin receptors which are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This receptor has been associated with nitric oxide formation, and it has been localized to cholinergic and nitrergic neurons as well as on smooth muscle cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced anxiety, pain and stress-related responses, reduced immunological response after a viral challenge, and reduced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Erc1 T A 6: 119,773,822 N466I probably damaging Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fbxo41 G T 6: 85,484,533 F64L probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Slco6b1 C T 1: 96,947,631 noncoding transcript Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 127,022,837 probably null Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Tacr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Tacr1 APN 6 82403655 missense probably benign 0.01
IGL01875:Tacr1 APN 6 82557016 missense probably benign 0.18
IGL02092:Tacr1 APN 6 82403919 missense probably damaging 1.00
IGL02506:Tacr1 APN 6 82403758 missense probably damaging 1.00
IGL02651:Tacr1 APN 6 82492641 missense probably damaging 0.98
R0627:Tacr1 UTSW 6 82555031 missense possibly damaging 0.93
R0732:Tacr1 UTSW 6 82552901 missense probably damaging 1.00
R1279:Tacr1 UTSW 6 82557183 nonsense probably null
R1292:Tacr1 UTSW 6 82554875 missense probably damaging 0.98
R1480:Tacr1 UTSW 6 82492530 missense possibly damaging 0.47
R1595:Tacr1 UTSW 6 82403742 missense probably benign 0.05
R2061:Tacr1 UTSW 6 82492554 missense probably damaging 0.96
R2260:Tacr1 UTSW 6 82403775 missense probably damaging 1.00
R2697:Tacr1 UTSW 6 82492597 missense probably damaging 1.00
R2941:Tacr1 UTSW 6 82403734 missense probably damaging 1.00
R4629:Tacr1 UTSW 6 82403880 missense probably benign 0.02
R4780:Tacr1 UTSW 6 82557072 missense probably benign
R4916:Tacr1 UTSW 6 82554941 missense probably benign 0.00
R5065:Tacr1 UTSW 6 82554878 missense possibly damaging 0.94
R6919:Tacr1 UTSW 6 82557073 missense probably benign 0.03
R6941:Tacr1 UTSW 6 82403865 missense possibly damaging 0.75
R7269:Tacr1 UTSW 6 82492711 missense probably benign
R8717:Tacr1 UTSW 6 82403725 missense probably damaging 1.00
R8912:Tacr1 UTSW 6 82557033 missense probably damaging 0.99
Z1177:Tacr1 UTSW 6 82554997 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTTCAAGCATGCCTTTCG -3'
(R):5'- TGACCTTTCCCCAAAAGCTC -3'

Sequencing Primer
(F):5'- AAGCATGCCTTTCGCTGCTG -3'
(R):5'- AGCTCCAGTGTTAGGGTATTTCCAAC -3'
Posted On2016-12-15