Incidental Mutation 'R5801:Fbxo41'
ID448344
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5801 (G1)
Quality Score140
Status Validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85484533 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 64 (F64L)
Ref Sequence ENSEMBL: ENSMUSP00000124754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably damaging
Transcript: ENSMUST00000159062
AA Change: F64L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: F64L

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161078
AA Change: F64L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: F64L

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161546
AA Change: F64L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: F64L

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Erc1 T A 6: 119,773,822 N466I probably damaging Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Slco6b1 C T 1: 96,947,631 noncoding transcript Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Tacr1 T A 6: 82,557,153 S387T probably benign Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 127,022,837 probably null Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R2067:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4520:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4522:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5334:Fbxo41 UTSW 6 85478483 missense probably damaging 1.00
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
R8801:Fbxo41 UTSW 6 85484681 missense probably damaging 1.00
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGATGCCACGGACTTG -3'
(R):5'- AGCCTCCTTGATCTCGCAG -3'

Sequencing Primer
(F):5'- TTGCGCGCAAACAGCTC -3'
(R):5'- TCGCTGGACCTACCGTAC -3'
Posted On2016-12-15