Incidental Mutation 'R5801:Tsfm'
ID448365
Institutional Source Beutler Lab
Gene Symbol Tsfm
Ensembl Gene ENSMUSG00000040521
Gene NameTs translation elongation factor, mitochondrial
SynonymsEF-TS, 9430024O13Rik, 2310050B20Rik, EF-Tsmt
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5801 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location127011572-127030840 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCACTCC to TCACTCCACTCC at 127022837 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000040560] [ENSMUST00000120547] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040560
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120547
SMART Domains Protein: ENSMUSP00000113446
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 3.4e-10 PFAM
Pfam:EF_TS 101 192 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129173
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145476
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Erc1 T A 6: 119,773,822 N466I probably damaging Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fbxo41 G T 6: 85,484,533 F64L probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Slco6b1 C T 1: 96,947,631 noncoding transcript Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Tacr1 T A 6: 82,557,153 S387T probably benign Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Tsfm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tsfm APN 10 127028442 nonsense probably null
IGL00910:Tsfm APN 10 127028359 intron probably benign
IGL01553:Tsfm APN 10 127028390 missense probably benign 0.01
R0123:Tsfm UTSW 10 127022929 intron probably benign
R0129:Tsfm UTSW 10 127030470 missense probably benign 0.28
R0134:Tsfm UTSW 10 127022929 intron probably benign
R1689:Tsfm UTSW 10 127028455 missense probably damaging 1.00
R2004:Tsfm UTSW 10 127030794 missense probably damaging 1.00
R2144:Tsfm UTSW 10 127028445 nonsense probably null
R4574:Tsfm UTSW 10 127028373 missense probably damaging 0.99
R4690:Tsfm UTSW 10 127030678 intron probably benign
R5141:Tsfm UTSW 10 127029613 missense probably damaging 0.98
R5371:Tsfm UTSW 10 127011643 missense probably benign 0.03
R5949:Tsfm UTSW 10 127028375 missense probably damaging 1.00
R6959:Tsfm UTSW 10 127022909 missense probably benign 0.05
R7248:Tsfm UTSW 10 127011631 missense probably benign 0.31
R7499:Tsfm UTSW 10 127022548 missense possibly damaging 0.94
R7810:Tsfm UTSW 10 127011689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCCAGTGTAATGGAAGGATC -3'
(R):5'- CGGACAGAAAGGTCACCATC -3'

Sequencing Primer
(F):5'- ATCCAGGAGGTACGGCTG -3'
(R):5'- ATCCACAGCTCACGTGGGTG -3'
Posted On2016-12-15