Incidental Mutation 'R5801:Wdr35'
ID 448371
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
MMRRC Submission 043390-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5801 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 9023897-9078848 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9056723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 503 (T503A)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
AlphaFold Q8BND3
Predicted Effect possibly damaging
Transcript: ENSMUST00000085745
AA Change: T503A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: T503A

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111113
AA Change: T492A

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: T492A

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Adam15 C T 3: 89,249,668 (GRCm39) V667I probably damaging Het
Adamts14 T C 10: 61,038,775 (GRCm39) S912G probably damaging Het
Adamts20 C A 15: 94,245,551 (GRCm39) E584* probably null Het
Ago3 A T 4: 126,265,561 (GRCm39) N284K possibly damaging Het
Alx3 T A 3: 107,512,257 (GRCm39) Y298* probably null Het
Arhgap32 A G 9: 32,167,084 (GRCm39) I574V probably benign Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Caskin2 T C 11: 115,694,299 (GRCm39) D400G probably damaging Het
Cdc73 T A 1: 143,484,281 (GRCm39) H525L probably benign Het
Cep135 A G 5: 76,778,523 (GRCm39) E674G probably damaging Het
Cic G A 7: 24,970,863 (GRCm39) R198Q possibly damaging Het
Col5a2 T C 1: 45,428,641 (GRCm39) probably null Het
Col6a5 A G 9: 105,825,566 (GRCm39) V9A unknown Het
Cpsf7 A T 19: 10,516,996 (GRCm39) D366V probably benign Het
Cuedc2 T C 19: 46,319,796 (GRCm39) E173G probably damaging Het
D5Ertd579e T C 5: 36,761,913 (GRCm39) E1318G probably damaging Het
Ddx55 T C 5: 124,704,560 (GRCm39) probably null Het
Dennd1b T A 1: 138,967,727 (GRCm39) probably null Het
Dpy19l3 T C 7: 35,424,723 (GRCm39) T111A probably benign Het
Edn1 C A 13: 42,460,282 (GRCm39) A179E probably benign Het
Eif2b1 T C 5: 124,712,775 (GRCm39) probably null Het
Epha5 A G 5: 84,479,085 (GRCm39) probably null Het
Erc1 T A 6: 119,750,783 (GRCm39) N466I probably damaging Het
Ermp1 A G 19: 29,590,228 (GRCm39) F825L probably damaging Het
Fbh1 T C 2: 11,774,637 (GRCm39) D36G probably damaging Het
Fbxo41 G T 6: 85,461,515 (GRCm39) F64L probably damaging Het
Gabrb2 T C 11: 42,312,216 (GRCm39) S14P probably benign Het
Gm6505 A T 3: 28,819,116 (GRCm39) noncoding transcript Het
Ighv1-18 T A 12: 114,646,328 (GRCm39) D91V probably damaging Het
Imp3 A G 9: 56,845,086 (GRCm39) D99G probably benign Het
Iqub T C 6: 24,449,768 (GRCm39) K699R probably benign Het
Itpk1 A G 12: 102,540,204 (GRCm39) V293A probably damaging Het
Lrrc49 A T 9: 60,509,916 (GRCm39) F157L probably damaging Het
Mapk1ip1 T A 7: 138,438,239 (GRCm39) T64S possibly damaging Het
Mrpl9 T C 3: 94,355,103 (GRCm39) L225P possibly damaging Het
Ms4a14 A G 19: 11,279,150 (GRCm39) L1136S possibly damaging Het
Ms4a14 A T 19: 11,279,246 (GRCm39) I1104K possibly damaging Het
Nkain2 T C 10: 32,278,264 (GRCm39) T54A probably damaging Het
Ociad2 A G 5: 73,483,642 (GRCm39) F60S probably damaging Het
Or1e1f T C 11: 73,855,772 (GRCm39) F113L probably benign Het
Polk T A 13: 96,620,094 (GRCm39) H723L probably damaging Het
Prickle4 C A 17: 47,999,698 (GRCm39) R285L possibly damaging Het
Psmd2 A G 16: 20,473,672 (GRCm39) N121S probably damaging Het
Rab11fip5 T A 6: 85,314,582 (GRCm39) S1212C probably damaging Het
Rasgef1c T G 11: 49,860,883 (GRCm39) M266R probably damaging Het
Rpusd4 A G 9: 35,181,369 (GRCm39) E155G possibly damaging Het
Rrbp1 A G 2: 143,831,703 (GRCm39) S155P probably damaging Het
Safb2 T C 17: 56,870,103 (GRCm39) Y991C possibly damaging Het
Shank1 G A 7: 44,006,240 (GRCm39) E1986K possibly damaging Het
Slc22a14 A G 9: 119,001,149 (GRCm39) F482L probably benign Het
Slc35e3 T A 10: 117,581,767 (GRCm39) M109L probably benign Het
Slco4c1 T C 1: 96,799,809 (GRCm39) N9S probably damaging Het
Slco6b1 C T 1: 96,875,356 (GRCm39) noncoding transcript Het
Sptan1 A G 2: 29,920,613 (GRCm39) probably null Het
Sptlc2 T C 12: 87,388,545 (GRCm39) probably null Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Strip1 A C 3: 107,528,757 (GRCm39) L391R possibly damaging Het
Tacr1 T A 6: 82,534,134 (GRCm39) S387T probably benign Het
Thbs2 A T 17: 14,908,125 (GRCm39) F213I probably damaging Het
Thbs3 A T 3: 89,131,704 (GRCm39) Y692F probably benign Het
Tktl2 C A 8: 66,966,299 (GRCm39) A619E probably benign Het
Tmc3 A T 7: 83,271,686 (GRCm39) E946V possibly damaging Het
Tmem132d A G 5: 127,861,964 (GRCm39) V719A possibly damaging Het
Trpa1 T C 1: 14,968,302 (GRCm39) H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 126,858,706 (GRCm39) probably null Het
Zfp109 T C 7: 23,928,126 (GRCm39) K436E probably damaging Het
Zfp423 A G 8: 88,585,990 (GRCm39) Y78H probably damaging Het
Zfp970 A G 2: 177,165,151 (GRCm39) K26E probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9,069,900 (GRCm39) missense probably benign
IGL00962:Wdr35 APN 12 9,071,726 (GRCm39) splice site probably benign
IGL01094:Wdr35 APN 12 9,055,838 (GRCm39) splice site probably benign
IGL01312:Wdr35 APN 12 9,058,655 (GRCm39) missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9,058,550 (GRCm39) missense probably benign 0.04
IGL01490:Wdr35 APN 12 9,027,381 (GRCm39) missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9,058,535 (GRCm39) missense probably null 0.04
IGL02319:Wdr35 APN 12 9,077,480 (GRCm39) unclassified probably benign
IGL02548:Wdr35 APN 12 9,074,297 (GRCm39) missense probably benign 0.00
IGL02941:Wdr35 APN 12 9,077,507 (GRCm39) missense probably damaging 0.98
IGL03038:Wdr35 APN 12 9,024,185 (GRCm39) splice site probably benign
IGL03086:Wdr35 APN 12 9,058,692 (GRCm39) splice site probably null
IGL03207:Wdr35 APN 12 9,039,936 (GRCm39) missense probably damaging 0.98
IGL03327:Wdr35 APN 12 9,028,694 (GRCm39) splice site probably benign
R0362:Wdr35 UTSW 12 9,045,625 (GRCm39) unclassified probably benign
R0464:Wdr35 UTSW 12 9,077,472 (GRCm39) unclassified probably benign
R0487:Wdr35 UTSW 12 9,062,743 (GRCm39) critical splice donor site probably null
R0976:Wdr35 UTSW 12 9,036,104 (GRCm39) missense probably benign 0.03
R1349:Wdr35 UTSW 12 9,069,870 (GRCm39) splice site probably benign
R1663:Wdr35 UTSW 12 9,070,000 (GRCm39) missense probably benign 0.00
R1769:Wdr35 UTSW 12 9,062,728 (GRCm39) missense probably damaging 1.00
R1779:Wdr35 UTSW 12 9,035,772 (GRCm39) missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 9,027,435 (GRCm39) critical splice donor site probably null
R1893:Wdr35 UTSW 12 9,035,994 (GRCm39) missense probably benign
R2076:Wdr35 UTSW 12 9,074,281 (GRCm39) missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 9,024,955 (GRCm39) missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 9,028,628 (GRCm39) missense probably benign 0.01
R2281:Wdr35 UTSW 12 9,028,628 (GRCm39) missense probably benign 0.01
R2863:Wdr35 UTSW 12 9,078,060 (GRCm39) nonsense probably null
R3713:Wdr35 UTSW 12 9,077,648 (GRCm39) missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 9,036,077 (GRCm39) missense probably benign
R3934:Wdr35 UTSW 12 9,058,014 (GRCm39) missense probably damaging 1.00
R4360:Wdr35 UTSW 12 9,024,149 (GRCm39) utr 5 prime probably benign
R4402:Wdr35 UTSW 12 9,039,981 (GRCm39) missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9,065,995 (GRCm39) missense probably benign 0.00
R4656:Wdr35 UTSW 12 9,066,619 (GRCm39) missense probably benign 0.00
R4780:Wdr35 UTSW 12 9,068,150 (GRCm39) missense probably benign
R5092:Wdr35 UTSW 12 9,037,327 (GRCm39) missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9,058,487 (GRCm39) missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9,068,142 (GRCm39) missense probably damaging 1.00
R5346:Wdr35 UTSW 12 9,028,684 (GRCm39) missense probably benign 0.00
R5435:Wdr35 UTSW 12 9,039,951 (GRCm39) missense probably benign 0.01
R5472:Wdr35 UTSW 12 9,066,619 (GRCm39) missense probably benign 0.00
R5682:Wdr35 UTSW 12 9,031,125 (GRCm39) missense probably damaging 1.00
R5990:Wdr35 UTSW 12 9,066,511 (GRCm39) missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9,077,632 (GRCm39) missense probably benign 0.05
R6531:Wdr35 UTSW 12 9,028,685 (GRCm39) missense probably benign 0.00
R6746:Wdr35 UTSW 12 9,053,982 (GRCm39) splice site probably null
R6816:Wdr35 UTSW 12 9,077,724 (GRCm39) critical splice donor site probably null
R6863:Wdr35 UTSW 12 9,040,047 (GRCm39) missense probably damaging 0.97
R7088:Wdr35 UTSW 12 9,028,659 (GRCm39) missense probably benign 0.11
R7140:Wdr35 UTSW 12 9,072,785 (GRCm39) missense probably damaging 0.98
R7327:Wdr35 UTSW 12 9,037,312 (GRCm39) missense probably benign 0.10
R7403:Wdr35 UTSW 12 9,062,685 (GRCm39) missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9,054,105 (GRCm39) missense probably benign 0.00
R7438:Wdr35 UTSW 12 9,072,785 (GRCm39) missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9,055,773 (GRCm39) missense probably benign
R7491:Wdr35 UTSW 12 9,036,000 (GRCm39) missense probably benign 0.00
R7599:Wdr35 UTSW 12 9,074,886 (GRCm39) missense probably benign 0.01
R7620:Wdr35 UTSW 12 9,066,042 (GRCm39) missense probably benign 0.04
R7857:Wdr35 UTSW 12 9,058,113 (GRCm39) critical splice donor site probably null
R8289:Wdr35 UTSW 12 9,058,020 (GRCm39) missense probably benign 0.00
R8302:Wdr35 UTSW 12 9,078,110 (GRCm39) missense probably benign 0.09
R8433:Wdr35 UTSW 12 9,058,495 (GRCm39) missense probably damaging 1.00
R8479:Wdr35 UTSW 12 9,035,985 (GRCm39) missense probably benign 0.04
R8498:Wdr35 UTSW 12 9,058,626 (GRCm39) missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9,075,044 (GRCm39) critical splice donor site probably null
R9220:Wdr35 UTSW 12 9,036,000 (GRCm39) missense possibly damaging 0.49
R9368:Wdr35 UTSW 12 9,071,826 (GRCm39) missense probably benign 0.00
R9573:Wdr35 UTSW 12 9,078,014 (GRCm39) missense probably benign 0.00
R9596:Wdr35 UTSW 12 9,036,092 (GRCm39) missense probably benign 0.08
R9773:Wdr35 UTSW 12 9,039,990 (GRCm39) missense probably benign 0.03
X0066:Wdr35 UTSW 12 9,040,029 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTTAGGTGTTTCCCCATC -3'
(R):5'- GCACAAGCTTCAGAACGTCCTC -3'

Sequencing Primer
(F):5'- GGAGATCAAGATTTCATTGAAGTAGC -3'
(R):5'- ACAAGCTTCAGAACGTCCTCATTTC -3'
Posted On 2016-12-15