Incidental Mutation 'R5804:Olfr1262'
ID448390
Institutional Source Beutler Lab
Gene Symbol Olfr1262
Ensembl Gene ENSMUSG00000051313
Gene Nameolfactory receptor 1262
SynonymsGA_x6K02T2Q125-51434523-51435437, MOR234-1
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90000145-90008291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90002988 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 194 (I194T)
Ref Sequence ENSEMBL: ENSMUSP00000107133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061701] [ENSMUST00000111508] [ENSMUST00000131072] [ENSMUST00000213868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061701
AA Change: I194T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052387
Gene: ENSMUSG00000051313
AA Change: I194T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 9.9e-24 PFAM
Pfam:7tm_4 134 275 1.3e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111508
AA Change: I194T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107133
Gene: ENSMUSG00000051313
AA Change: I194T

DomainStartEndE-ValueType
Pfam:7tm_4 25 300 6.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 7.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131072
SMART Domains Protein: ENSMUSP00000121666
Gene: ENSMUSG00000051313

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 171 1.7e-8 PFAM
Pfam:7tm_1 36 238 3.2e-22 PFAM
Pfam:7tm_4 134 240 5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213868
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Olfr1262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1262 APN 2 90003021 missense possibly damaging 0.65
IGL03303:Olfr1262 APN 2 90002466 missense possibly damaging 0.88
R1216:Olfr1262 UTSW 2 90002478 missense probably benign 0.23
R1256:Olfr1262 UTSW 2 90002567 missense possibly damaging 0.61
R1860:Olfr1262 UTSW 2 90003146 missense probably benign 0.26
R1864:Olfr1262 UTSW 2 90002481 missense probably benign 0.02
R1918:Olfr1262 UTSW 2 90002574 missense probably benign 0.12
R2192:Olfr1262 UTSW 2 90002430 missense probably damaging 0.99
R3024:Olfr1262 UTSW 2 90003240 missense probably damaging 1.00
R4155:Olfr1262 UTSW 2 90002660 missense probably benign 0.35
R4956:Olfr1262 UTSW 2 90002843 missense probably benign 0.33
R5298:Olfr1262 UTSW 2 90002460 missense possibly damaging 0.92
R6766:Olfr1262 UTSW 2 90002532 missense probably benign 0.06
R7674:Olfr1262 UTSW 2 90003045 missense probably damaging 0.99
Z1176:Olfr1262 UTSW 2 90003048 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGACCATCATGAACCGACATG -3'
(R):5'- TGTGGAAGGAGATCACTGGTC -3'

Sequencing Primer
(F):5'- CCGACATGTATGTATTTTCTTAGTGG -3'
(R):5'- GGAGATCACTGGTCTCACATAC -3'
Posted On2016-12-15