Incidental Mutation 'R5804:Igsf21'
ID448395
Institutional Source Beutler Lab
Gene Symbol Igsf21
Ensembl Gene ENSMUSG00000040972
Gene Nameimmunoglobulin superfamily, member 21
SynonymsLOC230868
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140026846-140246784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140028074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 423 (D423E)
Ref Sequence ENSEMBL: ENSMUSP00000046558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039331
AA Change: D423E

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046558
Gene: ENSMUSG00000040972
AA Change: D423E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 141 1.93e-5 SMART
IG 348 431 2.38e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which has two immunoglobulin (Ig) domains and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal differentiation of inhibitory synapses with decreased mIPSC frequency and prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Igsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Igsf21 APN 4 140027718 splice site probably benign
IGL01613:Igsf21 APN 4 140107364 missense possibly damaging 0.75
IGL01618:Igsf21 APN 4 140107364 missense possibly damaging 0.75
R1458:Igsf21 UTSW 4 140028124 missense probably damaging 1.00
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1793:Igsf21 UTSW 4 140034392 missense probably damaging 1.00
R1913:Igsf21 UTSW 4 140107312 missense probably benign
R2220:Igsf21 UTSW 4 140028114 missense probably damaging 1.00
R4013:Igsf21 UTSW 4 140037469 missense possibly damaging 0.92
R4721:Igsf21 UTSW 4 140107310 missense probably benign 0.09
R4911:Igsf21 UTSW 4 140034623 missense probably benign 0.01
R5157:Igsf21 UTSW 4 140028067 missense possibly damaging 0.53
R5725:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R5778:Igsf21 UTSW 4 140037521 missense probably benign 0.28
R6140:Igsf21 UTSW 4 140107373 missense probably benign 0.10
R6778:Igsf21 UTSW 4 140034648 missense probably benign 0.05
R6888:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R6963:Igsf21 UTSW 4 140027730 missense probably benign 0.02
R7203:Igsf21 UTSW 4 140107337 missense possibly damaging 0.70
R7485:Igsf21 UTSW 4 140027738 missense probably benign 0.09
R7880:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
R7963:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
Z1176:Igsf21 UTSW 4 140067215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACAATGGGATGGTACGACC -3'
(R):5'- ATGAGGTCTTCCCAGAACCC -3'

Sequencing Primer
(F):5'- TGGTACGACCATGTTACAAATAGG -3'
(R):5'- CATGTTCACGTGGACGAGAG -3'
Posted On2016-12-15