Mutagenetix > Incidental Mutations

Incidental Mutation 'R5804:Hfm1'

448399

Institutional Source

Beutler Lab

Gene Symbol

Hfm1

Ensembl Gene

ENSMUSG00000043410

Gene Name

HFM1, ATP-dependent DNA helicase homolog

Synonyms

LOC381663, A330009G12Rik, Mer3, Sec63d1

MMRRC Submission

043211-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R5804 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106840192-106926321 bp(-) (GRCm38)

Type of Mutation

splice site (214 bp from exon)

DNA Base Change (assembly)

A to G at 106878589 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000117588] [ENSMUST00000148495]

Predicted Effect

probably null
Transcript: ENSMUST00000112690

SMART Domains

Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000117588

SMART Domains

Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000117588

SMART Domains

Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000148495

Predicted Effect

probably null
Transcript: ENSMUST00000155171

SMART Domains

Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
Sec63	33	304	3.04e-42	SMART
Blast:Sec63	344	402	7e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183903

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	G	11: 101,990,814	N112S	probably damaging	Het
Abat	A	T	16: 8,578,236	R19*	probably null	Het
Abcb9	A	G	5: 124,080,055	M406T	probably benign	Het
Ager	A	G	17: 34,598,183	E32G	probably damaging	Het
Cdk10	T	A	8: 123,228,840		probably null	Het
Ctsl	A	T	13: 64,366,488	Y259N	probably damaging	Het
Ctu2	T	C	8: 122,481,226		probably null	Het
Dse	T	A	10: 34,153,379	I572F	possibly damaging	Het
Flt1	A	T	5: 147,580,437		probably null	Het
Gatm	T	A	2: 122,602,602	Y193F	probably benign	Het
Gpaa1	T	C	15: 76,332,626	F170S	probably damaging	Het
Grm3	A	G	5: 9,570,155	L363P	probably benign	Het
Heatr5b	G	A	17: 78,831,522	P64S	probably damaging	Het
Hivep2	A	C	10: 14,133,775	K1725N	probably benign	Het
Hmcn1	A	T	1: 150,674,347	C2695*	probably null	Het
Hmgcr	G	A	13: 96,666,187	T68M	probably damaging	Het
Igsf21	A	T	4: 140,028,074	D423E	possibly damaging	Het
Jag1	T	C	2: 137,088,204	N751S	probably benign	Het
Klrc2	A	T	6: 129,660,473	N28K	possibly damaging	Het
Lrrc8c	A	T	5: 105,579,557	D29V	possibly damaging	Het
Mtcl1	A	C	17: 66,343,137	S1329A	probably benign	Het
Nin	C	T	12: 70,045,601	V645I	possibly damaging	Het
Olfr1006	T	A	2: 85,674,338	D271V	probably damaging	Het
Olfr1262	T	C	2: 90,002,988	I194T	possibly damaging	Het
Olfr283	T	A	15: 98,378,334	M259L	probably benign	Het
Olfr640	T	C	7: 104,022,232	I29V	probably benign	Het
Pfpl	A	T	19: 12,429,663	H426L	probably benign	Het
Poteg	A	G	8: 27,456,798	D238G	probably damaging	Het
Psen1	T	C	12: 83,731,700	F386L	probably damaging	Het
Rassf9	A	T	10: 102,545,044	I96F	probably damaging	Het
Robo1	T	C	16: 73,043,189		probably null	Het
Slc16a4	A	T	3: 107,298,964	M117L	probably benign	Het
Slc4a8	A	G	15: 100,791,625	N372S	possibly damaging	Het
Stmn4	G	A	14: 66,356,299	G47D	probably benign	Het
Tex26	A	G	5: 149,463,147	N137S	possibly damaging	Het
Ttn	T	A	2: 76,916,819	I4629F	probably benign	Het
Ubash3a	G	A	17: 31,208,232		probably null	Het
Ube2cbp	T	C	9: 86,425,348	I233V	probably benign	Het
Utrn	T	A	10: 12,421,625	T680S	probably damaging	Het
Vps13d	G	A	4: 145,100,070	T2846I	probably benign	Het
Zbtb22	TGGACCCGGGAC	TGGACCCGGGACCCGGGAC	17: 33,918,619		probably null	Het
Zfp41	C	T	15: 75,618,708	P170S	probably damaging	Het

Other mutations in Hfm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Hfm1	APN	5	106902130	missense	possibly damaging	0.70
IGL01295:Hfm1	APN	5	106917606	missense	possibly damaging	0.46
IGL01725:Hfm1	APN	5	106917379	missense	probably benign	0.00
IGL01758:Hfm1	APN	5	106904793	missense	probably damaging	0.99
IGL01911:Hfm1	APN	5	106911544	missense	possibly damaging	0.92
IGL02337:Hfm1	APN	5	106904267	missense	possibly damaging	0.81
IGL02472:Hfm1	APN	5	106873928	splice site	probably benign
IGL02496:Hfm1	APN	5	106901761	missense	probably benign	0.00
IGL02545:Hfm1	APN	5	106895287	missense	probably damaging	1.00
IGL02584:Hfm1	APN	5	106878662	splice site	probably null
IGL02728:Hfm1	APN	5	106878823	missense	probably benign	0.13
IGL02881:Hfm1	APN	5	106874252	missense	probably damaging	1.00
IGL03108:Hfm1	APN	5	106895934	unclassified	probably benign
IGL03351:Hfm1	APN	5	106911575	nonsense	probably null
IGL03353:Hfm1	APN	5	106856929	missense	probably damaging	0.99
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0094:Hfm1	UTSW	5	106917478	missense	probably benign
R0633:Hfm1	UTSW	5	106917601	missense	possibly damaging	0.56
R0644:Hfm1	UTSW	5	106898256	critical splice donor site	probably null
R1078:Hfm1	UTSW	5	106878830	missense	probably damaging	1.00
R1120:Hfm1	UTSW	5	106904218	splice site	probably benign
R1166:Hfm1	UTSW	5	106911411	missense	probably benign	0.00
R1242:Hfm1	UTSW	5	106874901	missense	probably damaging	0.99
R1414:Hfm1	UTSW	5	106872353	missense	probably benign	0.01
R1450:Hfm1	UTSW	5	106918458	missense	probably damaging	0.99
R1529:Hfm1	UTSW	5	106853123	missense	probably benign	0.00
R1622:Hfm1	UTSW	5	106893523	missense	possibly damaging	0.58
R1710:Hfm1	UTSW	5	106880514	missense	probably damaging	1.00
R1710:Hfm1	UTSW	5	106896003	missense	probably damaging	0.96
R1757:Hfm1	UTSW	5	106880360	splice site	probably null
R1856:Hfm1	UTSW	5	106847676	missense	probably benign	0.00
R1984:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R1985:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R2040:Hfm1	UTSW	5	106901818	missense	probably damaging	1.00
R2122:Hfm1	UTSW	5	106896255	missense	probably damaging	1.00
R2426:Hfm1	UTSW	5	106847653	splice site	probably null
R2474:Hfm1	UTSW	5	106872416	missense	possibly damaging	0.81
R2926:Hfm1	UTSW	5	106874282	nonsense	probably null
R2944:Hfm1	UTSW	5	106872330	missense	probably damaging	1.00
R3705:Hfm1	UTSW	5	106892839	unclassified	probably benign
R4256:Hfm1	UTSW	5	106904797	missense	possibly damaging	0.83
R4455:Hfm1	UTSW	5	106886508	splice site	probably null
R4538:Hfm1	UTSW	5	106874890	missense	possibly damaging	0.47
R4540:Hfm1	UTSW	5	106874221	nonsense	probably null
R4591:Hfm1	UTSW	5	106847667	missense	probably benign	0.08
R4745:Hfm1	UTSW	5	106901843	missense	possibly damaging	0.87
R4747:Hfm1	UTSW	5	106917523	missense	probably benign
R4765:Hfm1	UTSW	5	106842539	missense	probably benign	0.21
R4821:Hfm1	UTSW	5	106854740	critical splice donor site	probably null
R4842:Hfm1	UTSW	5	106892751	missense	probably damaging	1.00
R4944:Hfm1	UTSW	5	106874213	missense	possibly damaging	0.46
R5093:Hfm1	UTSW	5	106901731	missense	probably damaging	1.00
R5399:Hfm1	UTSW	5	106917562	missense	possibly damaging	0.91
R5414:Hfm1	UTSW	5	106902076	missense	probably damaging	1.00
R5436:Hfm1	UTSW	5	106892772	missense	possibly damaging	0.61
R5459:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5485:Hfm1	UTSW	5	106847662	critical splice donor site	probably null
R5585:Hfm1	UTSW	5	106911439	missense	probably benign	0.05
R5631:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5705:Hfm1	UTSW	5	106911453	missense	probably benign	0.21
R5959:Hfm1	UTSW	5	106874917	missense	probably damaging	1.00
R6046:Hfm1	UTSW	5	106898643	splice site	probably null
R6191:Hfm1	UTSW	5	106886553	missense	possibly damaging	0.95
R6345:Hfm1	UTSW	5	106841638	missense	probably benign
R6580:Hfm1	UTSW	5	106847709	missense	probably benign	0.00
R6651:Hfm1	UTSW	5	106847687	missense	probably benign	0.00
R6761:Hfm1	UTSW	5	106895279	missense	probably damaging	1.00
R6835:Hfm1	UTSW	5	106878815	nonsense	probably null
R6891:Hfm1	UTSW	5	106917374	missense	possibly damaging	0.49
R6924:Hfm1	UTSW	5	106850410	splice site	probably null
R6980:Hfm1	UTSW	5	106880477	missense	probably benign	0.31
R7054:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7058:Hfm1	UTSW	5	106911440	missense	probably benign	0.04
R7189:Hfm1	UTSW	5	106901703	critical splice donor site	probably null
R7250:Hfm1	UTSW	5	106904331	missense	probably benign	0.00
R7376:Hfm1	UTSW	5	106895218	missense	possibly damaging	0.95
R7577:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7636:Hfm1	UTSW	5	106917466	missense	probably benign	0.02
R7639:Hfm1	UTSW	5	106889925	missense	probably benign	0.03
R7639:Hfm1	UTSW	5	106898475	missense	possibly damaging	0.46
R7763:Hfm1	UTSW	5	106881861	missense	probably damaging	1.00
R7828:Hfm1	UTSW	5	106881791	critical splice donor site	probably null
R7905:Hfm1	UTSW	5	106898553	missense	probably damaging	1.00
R8160:Hfm1	UTSW	5	106896033	missense	probably null	0.00
R8477:Hfm1	UTSW	5	106881818	missense	probably benign	0.01
R8739:Hfm1	UTSW	5	106898505	missense	probably damaging	0.96
R8968:Hfm1	UTSW	5	106917573	missense	probably benign	0.00
R9072:Hfm1	UTSW	5	106898280	missense	probably benign	0.04
Z1177:Hfm1	UTSW	5	106871820	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACCGATTGTTTTGCATCGC -3'
(R):5'- CTCACGAATTGCAAGATGTATGTTG -3'

Sequencing Primer
(F):5'- CAGAGGAGCAAGTTCTCTCTTCG -3'
(R):5'- AATGGATTTTCAACGTTCTCCCAG -3'

Posted On

2016-12-15