Incidental Mutation 'R5804:Hfm1'
ID448399
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationintron (214 bp from exon)
DNA Base Change (assembly) A to G at 106878589 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect probably null
Transcript: ENSMUST00000112690
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000117588
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000117588
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect probably null
Transcript: ENSMUST00000155171
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183903
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 intron probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 intron probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R7988:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCGATTGTTTTGCATCGC -3'
(R):5'- CTCACGAATTGCAAGATGTATGTTG -3'

Sequencing Primer
(F):5'- CAGAGGAGCAAGTTCTCTCTTCG -3'
(R):5'- AATGGATTTTCAACGTTCTCCCAG -3'
Posted On2016-12-15