Incidental Mutation 'R5804:Abcb9'
ID448400
Institutional Source Beutler Lab
Gene Symbol Abcb9
Ensembl Gene ENSMUSG00000029408
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 9
SynonymsTAPL
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124061530-124095798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124080055 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 406 (M406T)
Ref Sequence ENSEMBL: ENSMUSP00000031354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031354] [ENSMUST00000126856] [ENSMUST00000141510]
Predicted Effect probably benign
Transcript: ENSMUST00000031354
AA Change: M406T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031354
Gene: ENSMUSG00000029408
AA Change: M406T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 184 453 1.9e-61 PFAM
AAA 527 713 4.07e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126856
SMART Domains Protein: ENSMUSP00000118908
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141510
SMART Domains Protein: ENSMUSP00000122969
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196486
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may be associated with lysosome activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Abcb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Abcb9 APN 5 124077238 missense possibly damaging 0.90
R0045:Abcb9 UTSW 5 124082085 missense probably damaging 0.96
R0106:Abcb9 UTSW 5 124083060 missense possibly damaging 0.70
R0153:Abcb9 UTSW 5 124080056 missense probably benign 0.00
R0194:Abcb9 UTSW 5 124077295 missense probably damaging 0.99
R0458:Abcb9 UTSW 5 124082146 critical splice acceptor site probably null
R0669:Abcb9 UTSW 5 124062887 missense probably damaging 0.97
R1240:Abcb9 UTSW 5 124089921 missense probably benign 0.02
R1480:Abcb9 UTSW 5 124078826 missense probably benign 0.00
R1544:Abcb9 UTSW 5 124083631 missense probably benign
R1878:Abcb9 UTSW 5 124090136 missense probably benign 0.02
R2355:Abcb9 UTSW 5 124077305 frame shift probably null
R2358:Abcb9 UTSW 5 124077305 frame shift probably null
R2520:Abcb9 UTSW 5 124080028 splice site probably null
R2926:Abcb9 UTSW 5 124078839 missense possibly damaging 0.84
R3795:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R3911:Abcb9 UTSW 5 124089846 missense probably benign 0.06
R4679:Abcb9 UTSW 5 124078804 missense probably benign 0.20
R4789:Abcb9 UTSW 5 124078790 missense probably benign 0.00
R4821:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R5116:Abcb9 UTSW 5 124078867 missense probably damaging 1.00
R5997:Abcb9 UTSW 5 124089815 missense possibly damaging 0.85
R6197:Abcb9 UTSW 5 124071749 nonsense probably null
R7172:Abcb9 UTSW 5 124062806 nonsense probably null
R7705:Abcb9 UTSW 5 124081955 nonsense probably null
R7783:Abcb9 UTSW 5 124078812 nonsense probably null
R8043:Abcb9 UTSW 5 124073602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACATGCTCCTACCGACCCTG -3'
(R):5'- TCATCAGTTAGGAGGCGATGG -3'

Sequencing Primer
(F):5'- ACCCTGCCACCTTGTAGG -3'
(R):5'- TGTGCACAGAGGCTCTCCAAG -3'
Posted On2016-12-15