Incidental Mutation 'R5804:1700006E09Rik'
ID448414
Institutional Source Beutler Lab
Gene Symbol 1700006E09Rik
Ensembl Gene ENSMUSG00000010841
Gene NameRIKEN cDNA 1700006E09 gene
Synonyms
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101984279-101992264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101990814 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 112 (N112S)
Ref Sequence ENSEMBL: ENSMUSP00000010985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000175972] [ENSMUST00000176722]
Predicted Effect probably damaging
Transcript: ENSMUST00000010985
AA Change: N112S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841
AA Change: N112S

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect probably damaging
Transcript: ENSMUST00000176722
AA Change: N61S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841
AA Change: N61S

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in 1700006E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:1700006E09Rik APN 11 101990820 missense possibly damaging 0.75
IGL02442:1700006E09Rik APN 11 101990826 missense probably benign 0.00
R1802:1700006E09Rik UTSW 11 101988476 missense possibly damaging 0.56
R1937:1700006E09Rik UTSW 11 101987163 missense probably damaging 0.97
R2015:1700006E09Rik UTSW 11 101987218 missense probably damaging 1.00
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3733:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3813:1700006E09Rik UTSW 11 101991488 missense probably benign 0.01
R7351:1700006E09Rik UTSW 11 101991505 missense probably benign 0.01
R7451:1700006E09Rik UTSW 11 101991457 missense possibly damaging 0.85
R8546:1700006E09Rik UTSW 11 101990861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCTCAACACTAAGACCTAAG -3'
(R):5'- AAGGGTGAGCCTCTCTGATG -3'

Sequencing Primer
(F):5'- GACCAGACTTCTAGCAGGCAGTG -3'
(R):5'- TGAGCCTCTCTGATGAGCATAGAC -3'
Posted On2016-12-15