Incidental Mutation 'R5804:Psen1'
ID448416
Institutional Source Beutler Lab
Gene Symbol Psen1
Ensembl Gene ENSMUSG00000019969
Gene Namepresenilin 1
SynonymsPS1, PS-1, S182, presenilin-1, Ad3h
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83688152-83735199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83731700 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 386 (F386L)
Ref Sequence ENSEMBL: ENSMUSP00000098786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041806] [ENSMUST00000101225]
Predicted Effect probably damaging
Transcript: ENSMUST00000041806
AA Change: F386L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048363
Gene: ENSMUSG00000019969
AA Change: F386L

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101225
AA Change: F386L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098786
Gene: ENSMUSG00000019969
AA Change: F386L

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222646
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deformed axial skeletons, reduced Notch signaling, impaired brain growth with a deficiency of neural stem cells, cerebral hemorrhages, inhibited cleavage of amyloid precursor protein, and perinatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Psen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Psen1 APN 12 83730569 missense probably benign 0.01
IGL00793:Psen1 APN 12 83723018 missense probably damaging 0.98
IGL03171:Psen1 APN 12 83714864 missense probably damaging 1.00
hiortron UTSW 12 83724665 missense probably damaging 1.00
R0685:Psen1 UTSW 12 83714820 nonsense probably null
R1394:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1395:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1681:Psen1 UTSW 12 83724620 missense probably damaging 1.00
R2257:Psen1 UTSW 12 83714820 missense probably damaging 1.00
R4833:Psen1 UTSW 12 83731778 missense probably benign 0.23
R5077:Psen1 UTSW 12 83724665 missense probably damaging 1.00
R5170:Psen1 UTSW 12 83714862 missense probably damaging 1.00
R5782:Psen1 UTSW 12 83712459 missense possibly damaging 0.54
R7458:Psen1 UTSW 12 83714766 missense probably damaging 1.00
R7494:Psen1 UTSW 12 83728243 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTGAACTGTACACACCACTTACTG -3'
(R):5'- ACACGACTGCCACAGTATCTG -3'

Sequencing Primer
(F):5'- CTCTTTCAGTGCGGGACAAAG -3'
(R):5'- CAGAATCAGTTTCCTGACC -3'
Posted On2016-12-15