Incidental Mutation 'R5804:Ubash3a'
ID448426
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 31208232 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656] [ENSMUST00000144772] [ENSMUST00000173776] [ENSMUST00000173776]
Predicted Effect probably null
Transcript: ENSMUST00000048656
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144772
SMART Domains Protein: ENSMUSP00000119279
Gene: ENSMUSG00000042345

DomainStartEndE-ValueType
Pfam:UBA 21 57 8.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151620
Predicted Effect probably null
Transcript: ENSMUST00000173776
SMART Domains Protein: ENSMUSP00000134557
Gene: ENSMUSG00000042345

DomainStartEndE-ValueType
Pfam:UBA 21 57 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173776
SMART Domains Protein: ENSMUSP00000134557
Gene: ENSMUSG00000042345

DomainStartEndE-ValueType
Pfam:UBA 21 57 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R3800:Ubash3a UTSW 17 31231470 missense probably benign 0.24
R4125:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4127:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5311:Ubash3a UTSW 17 31219717 missense probably damaging 0.99
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7458:Ubash3a UTSW 17 31208165 missense probably benign 0.02
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
R7991:Ubash3a UTSW 17 31237895 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCGAACATTGTGCAAACAGG -3'
(R):5'- GCCTTAGAGCCTCATGTCAG -3'

Sequencing Primer
(F):5'- CAGGATATTCACTTGTGTCAGAGAG -3'
(R):5'- TGGCTTCTAATGTGCACG -3'
Posted On2016-12-15